CR00504

CRIMIC CR00504

Gene CG8080

CG8080

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78933

Images

Construct Sequences

sgRNA sequence
CGAGGCACGCAACACAACATTGG

Amplicon 5' Amplicon 3'
CCATGTCCTGGTCCAGCATTTCGGGTGCGGTGCTGACCTGCTCCATCTTGACCTCCGTGTGGCGGAAAAGGTCAGTCGGCTCCGGAATATTGCCGTTGCTACCAAGCATCGTAGTCCGCACCCTCGAGCGATGCATCCACTTGAAATCTCCCTGCCAGGAATTTGAATATTTAATGAATGAATTGTGAGAAGTGGCTCGTTCCAGGACTTACGCTCTTGATGCGGGAAACGGCGTCGGCCGGATTATCCGAGTAGTGCTTGGGCAGCATGAGTCGGCCCTCCGAGTGAAGCGGATCCGAGTTGAAGCCCACGATCGGCGTCTTCTGCTGGCTGAGCGCGAAGAGCGGACTGGCGCGTCCGGCGGAGAGAAGGAAAGTGCCATCGCCGCCCACCGGCACGATGACGTCCGCCCAGCTCATGACGTCCTTGCTCAACGAGCTTCTAAATTCAAGTCTGCTCGTTTAGTAAAGTCAACACACAGGGTGAGGTGCCGCATGGGAGACACGAAGTGTGTGAAGATGGTGGAGATCAATTGTAGCGGGTAGTAGTCACAAATCGAAGATACATATAGGTATAGTATGTGACGAAGTGACGAGGC TTGGTGGCAGTGATTGGAGGCCTAAAGGTGTGGATGTCTGGGTACATGTCCTCATAGAACTAATCTCATTCAAAGCAATGAAATCATTTCCATGGCTTGAGTACATTTACTCATTTACTTGAGTACATGTACCTATGGCCTCCGTTGCTTTGAGCTGCACTCCGATCACTGAATTGGAGGACTACATGGGTACGCACCTGCTGGACAACTTCACCTCGCAGCCGACGTCCTGGAAGCTCTGCACGACCCGCCGCTCGAAGTCCTTGTGCACCTTGTGCAGATGGAGGACCATCTCCACGTCGGTGCCCCGGTCACGGAGCTTTTGCTGGAGCTGATCCGGAGACAGTTCCGGGTGGCGTAGCTGCTCGAACTCATAGCGGGACAGCTTGGTGACGACCAGGGCCCGCTTTAGCTTGAAGTTGGTCGGCGTATATTTAGCGTACTCTGTTCAAAATGGCAATTGCAAGCGAAAGACCTCGTTAGTCCGATCAAATGTGGGTCCTCGTCACGGGAAATTTACTCAAACCCTCGGGAATAATCTTCCTGCCGTTTTGAAGCATCCTACGGCCGAAATCGATGTGTAACTACTAGGTTTTAATGGAAATTTCCCGGAACAGCTGATAAACAACACAGTGCAAGTGGAAAGTATTTTCCCTCTAAAACTTTTAATGAAACAATGTTATGTATTTGGTTTGTACCAATCATGTTTTTCGTAGATTTTCCTAATGGTTTGACATACTGCAGTGAGCTTTAAATACCATTATTAAAGATAAGTAAAATCAAGCTATCCAGTATGTAAAATTTGTTTGTTTATAATCAATATAATTATAGCATAACAAAGTTTAGTGACACACACTTTGAGATCTGCGTTCAATACTTGTTGAAAAGTTGGTTAAGTTAAGTTAATCCGGAAACCAAAAAGGATATTTAAGATAATATCCACTTTCTGAGCGAATAATTTTGTCAGCCAGTGTGCGTGGGGAAAGTTCATCGTGACAAAGAATTTGGCGAAAAAGTGTTTACTGATAATCTTCGGCTTGGTCGGCGTCAGATGCGATTAA


Search Again