CR00503

CRIMIC CR00503

Gene Eaat2

CG3159

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78932

Images

Construct Sequences

sgRNA sequence
AGCGTTAAGCTCACATGTAGAGG

Amplicon 5' Amplicon 3'
ACAGAACTAATGCCCACGGGTGTCAGCCACATCACGCAGGTGACCATCTTCATGATCACCTCAAAAATGGCGGCAAAGAAGTCAACCACGACCTGACCCTTCTGGCCGATGGTTCCCAAAAAAGTACCAAACACCAGGCAGAAGAAGACGATGCCCAGGGTGTTGGTTCCACTGCGGTACTGGATGTCCCTCACCAGCACCACATCCTCCGTAAGGTCTTCAGACAAGCGTTGGGCCTCCGATCCGGATGCCAAGGTGTCATTCATCGTTTCGTTGAAGACGTGCAGGATACTCGGCTTGGGCAAGTAGACGGTGTGCGCCTGCTGAATGGAGGCCTGAAACAGGTTGTCCGGGAATACGTTCCTGAAGAAAAGAAGAAAATAAGAAAACACAGCTAATATTGAAATATGAAAATCAACTCTTGGAGCATATAAAAGATAAATATGTGTATGATTGTATCACAATTGGGTCGACTTTTAATGTCGATCTACTACAAACTACAAAATAATTTTCGTTGCACTGCTTCAAGCAGTTATATTCGTAAACTGCTTAGTCGTACTACAGAATCAGACTGCTTGCCAGGTTAAGACACTAGTTGCAGCGTTAAGC GCGCCACTGAGGATGCTAACAGGTTTTATAGCTTTTTATGTTGCTAAGAGCTACTTTTCGTATGCTACTTAAATGTAACTCACCTGCCCAAATCCAAAAGACTATCTAGAAGGTTAACTGCCCGCCGATCTGTAGATCGATCGTCCGCATTGTGCAGATCCGGATTTCCAGGATGGATGAGCAGAACGAGAGCGATTCCCAGTGCAGCGTTAAAGAACGAAGTGCTGGCAAAGTAAACCAACGTGCGCAGCGCTATCTTGCCGTTCATTTTGGCGTTAAGGCTGGCCGATCCGGCAATAAGGCTCGATATAACTAGCGGCAAAATCATCAGCTTGAGTACGCGCATAAACAGTTCGCCAGGATAGGAAATCAGCATGATGGAGTCCCCATGTAAATTAAGCGGCCGTAAGGAGAGTCCTGTCGGAAAAGTAGTACATTAATGGAATATTTCAGCATAACTATATTGCGTTGGCAATCAAAGTGTATGCACTAAAATTAGGTTGTCTGTTGAACTAATCGTACTTACCTAGTATTACACCAAGGAGAACTCCGGAAAGGGTGACCAGGAGCATTAGATTCTCGGAGAGCCACCT


Search Again