CR00502

CRIMIC CR00502

Gene chp

CG1744

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78931

Images

Construct Sequences

sgRNA sequence
AGGAACTTGAGAAGCCTTAGAGG

Amplicon 5' Amplicon 3'
GAAGGCGTGCGATTGAATCCCGGAGAGACTGGCCCTGGTGATCTGCAGATCCTCCAGCTCCACGCCGAAGTCCTTGAAGTCCTCGGGTCCCACGGAGGAGGATCCCAGGCGCGAGATCGACAGTGATCTCATGTTCCGCATTCTGGTCATACTTTTTGTAAATAAATACAAGAGTGGTTCTGGGGTGAAGGGTGTGTGGGGAGCAGGATGTTTCTCGGTGCACTGGGTTCACTTACTTGCGCAGGGTCTGCAGATTGGTGGGGTCGTTGCGGTCTCCACTCAGGTCCAATTTCAGGAGGGTGTAGTGCACCGCATTGAAGGTCTCCGTGGGCTTCTGGATCTTGATCTTATTGTCCCGCATGCTGATGACCCTATTATTAAGAAATAAATGTATAGAATTATAATTTACCATTATAAAATTCAATAATAGCTATGCAAATCAAGCTTTTTCTCAGTGCCGCGTATTTTTGCAAGATTGCCTGATTGCGCGGCTTTTCCCTCTTCCTCGAATTCTTTTAAATAGGGTCACCCACTTGTCGCACACACGAACTTAGGA GGCAATCCGATTAGTTCCCCCCAATATGCACATGTGCAAATGGAATGGGGGCAGAACGTGAGTGAATCGGAGTGCAGGTGCTCGACTCACCTCAAGACATCGAAATTGTTGAAGAGCTTATGATGCAGCTTGGTGAGATTGTTGCCAGACAAATCCAGGATCTGGAGGCTGTTCACCAGGCTGTCAAAGGCCACAGGCGAAATGTTGGTCAGGCCGCAGTAGCGCATGTAGATCTCCCTGATTCGAGCGGGCTTAAATGCATCTTCCTGAAAGCGAACCGTAAGTTCCAAATATGTTATTTATAAATCAAATTTCTGGGAGGGATTTTCGTCCAGTTAAGTTTCACAAGGGTTAGTTAACCTACCCTCAGAGTGTGAATGGGATTGCCATCGAAGAAGGTGCGGTTGACGGTATCGAAGTACTTGAATGAATTGGGAGGCAGGACCTCGATGTGATTGTACTCCAGGTGTAGATTGTCCAGATTCAGCTTGGTGCTGGCCTTGATCTCGTAGGTTTCGTTGCCACTGAGCGACCAGATCACATTGTGGGAGATATCTAGGGTGCGAAGGCTCTTTAGCGGACCCAGGGCGTCGTACGGAATCTCCGAGAGGATATTGTCCGTGAGCAACAGACGGGTCAGCCTCGGCATTCCATCGACGAACACATTCGGATCGATCTCGAACAGGTTGTTCCCACTCAGGTCGAGGGTCTCAAGAATGAGGAGCCCGGAGAAGCTGTGCGACATCAGCTGCGATATGCAGTTCTCGCGCAGGATCAGCGTCTGCAGCGAGTCCTCCAGGCCGCGGAACGAGTCGTGCTGAATGTGCGTTATGTGGTTGTAGCCCAGGTCCAGATGACGCAGCTTCTGCAGGTGCCTCAGGGACTTGGACGGGATCTCCACCAGGTCGTTCTGCGGCAGAATCAGCTCCCACAGCGATCGCTCCAGGCCGGTGAAGGCATCATCTGGGATCTCGGTGAGATGGT


Search Again