CR00500

CRIMIC CR00500

Gene bur

CG9242

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78930

Images

Construct Sequences

sgRNA sequence
GCAGCATTGTATCAGCGCTTAGG

Amplicon 5' Amplicon 3'
CGTGTCATTGTGGTGCGTTTTGATTGTTTCTGCATTCGTGCTCACCATGCTAGAGGCGGACTCGATCAGATCTGGTCGGAGGGTTCCCTGGGCCAACATAACTTCTTCGGGCTTTAGTTTCAATTCGGCTACTACATCATTGGTCACCTTGACGAATATATCACCAATTATCTTGCGTTTTTCCTCCGGATTGTATGTCTGACATAACATCGGCGTTTCCACCACGGAGTACTGTCCGGGCCTCTTGACCTGCGTGGTGCCTTTAAGGAACGTGTAGCCTTCTTTTCGGACGATTAAATCAATGCCAATATCGCGCAGTGAACGCTCCACCTTTTCACTTTCCTTCTTGCGCATGAAACCTTGAAGTAAGGGATAAAATATTAGGTTTTAAAGTACAAATGATATAAATTCGGTATTCACCGAGTTAATGAATTATTTGACGTAGAAAAAATATAAATGAATAAATTTCGCTAATCTGTCTACTGTCATACCATTATCTACATGCACGGCAATTATCTGATGAGGGTACAAAGCACGGCGGAGCAAAGCTGCACAGACACTCGAATCCACGCCGCCGCTGACCAGGAGCTGTAAAATGTAGATTGTATTGAGATATTCATGTCTTGATTGAAAATTTATTTTCCCAAACTCACCAACACCTTATTGTTGCCCACTTTCTCACGGATATAGCGTATGCACTCCTCCTTTCGACTACCCATGGTAAAGTTAGGTGTCAGTTCGCAGATTTCGTACAGGAAGTTCGATAGCATCTGTTTGCCATTGATAGTGAGGTCCACCTCAGGATGGAACTGTACGCCGTAGATGCGTAGTACTTCATTGTAAATGGCTGTCACAATGCGGTTTGTAGACCAGCCACCAATCTTCAGATTCTCGCCTACCCTCTCAACGCTATCTCCGTGGGTTAACAGCACGGACTGTGTGCGACTGAGGCGACTGCGGGAAACGAAGATGTTATGTTTGTTAATTGCATGTATTAGAATAATTAATGGTAATGATAGATAATATGTTAGGCCACGTGTAGATCAGTTTATAAACTACTCTAAACTAAACTGTTCTTGGCTTTAAAATTGTTCTGGCAGCATTGTATCAGCG AGGTAAACGCATTTAAGCCTAAGCACTTTCTTGTTGCTGCTTGTTTTGGGAATCAATATTTCCTGGCTCACCTAAAGAGCGGGCACGAGGTCTCGATCTCGATATTTTGTTGGCCATCCTCTCGAACATCCTTCTTGAGCACTGTGCCCCCGAACTCTTTGTTGATTAGCTGCATGCCGTAGCAGATGCCCAGCATAGGTATTTTTAGCTTGAACAGATCGGGATCATAGCTGGGCGCATCCTCAGCGTAGACTGAGTTGGGTCCGCCGGAGATGATGATGCCTCGATAGCCATTGTTGCGTATCGTGGCAGCTGGCGTATCCAGAGGAAGGATATCCGTCTCAACGAAGAGTTCGCGTACCTTACGGTCGATAACCTGCGGAGAAACCAGGACCATTTTAAGAAGAGGTTAAAACTACTCTTGGTTTTAAGCTTACCTTGCCGTACTGTGCTCCCGCATCAAGTATAACAATCTTATCATGCCGCAGGCCATTCTCTGCTGTGCCCAGAAAAATGTTTGAGTTCATTTCTTTATCGTTGCAGCACTGAAAAGAGCAAAGATTTGAGTGTCAGTCAAGCAATCGCAGAAACAAACACCGAATCTCGACTGGCTGGTAAACGCGCTTCTGCTGCTTATTTATACTCCAATTGTGGCTGCAATCGACGCTACAGAAACAAGGCTAAAAGCTGGCTAGGAGGTGGGGAAAATAGGTTTCGGATTGGGGCAATCGCGGAGATTGAGATTTGTGGTACAGAAGGCTCACATACCGGCAATATCTTGTGGAGCACTCGCAGAAACATTCAACATGCAGCTGGCCAGGACGCTCTACGATAGACAATAAACATTGGCAAATATTTTCTTGTCACAGAAAGATGATTTGTGCAATGTGGAAAGAAATTTACAAGCGACGAAAAACAAGGCCGAGAGACGCCTACCAAAAATGATTCGCTGTGCATCGC


Search Again