CR00499

CRIMIC CR00499

Gene mRpS30

CG8470

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78929

Images

Construct Sequences

sgRNA sequence
AGAACTCGGATTGGTTGGAGTGG

Amplicon 5' Amplicon 3'
ACTTTCCGTCGCTACCTTGGCGCAACCTATTCTGAATCCAGCGTGCGGTCACACTGCAGCAATGACATAACCTAGTTATTGTCAAAAAACTGAAGTCAATTCTATTCCTTCGAAAACATAAATCGTAACTTGCGTTAGGTTCGACGGCATGTTGAAGCTTAACCGTGTTCGCCATCTGCGAACGACGTACAAGCGCTGTTTGTCCGGCCAGTCGCAGCTGCAGCTGAATAGTACGGACGCAGAGCCGGCATATCCGGAGATTCAGGATCTGTCCTTCAAGGCGCGCAAGCAGAAGGATGCGGCCAACTGGCACGAGGAAATCCGGCAGGTGCCGACGGTGGAGGAGAAGATGATCAAGATCAATATGCCCCGCTATTACGGCTTCAAGGTGGTCGACTTCAACGACTCGAAAATCCCCTACAATGCACTGCCGCTCACGCAACATTATACGCGCACAGTGCTCGAGGATTTGCCATCTGAAACGGATAAGAAGGCACAGGCTAAGGACTCCGAGCAGGAGCAGGAGCAGCCGAGCGTGGATGGTCTTTTCAAGGCGGCTCGCGGGGATGTTATTGATGCCCTCGAGTTTGCCCACGACTACTACAAGTGGGTACAACGAGGTCCGCTTTCAACGAACCAAGTTCTCCGGCGAGTTTGTGGACAGTAGTTGGTCCAACTCACTTAAGAACTCGGATTGG TCCCAGTTACAAGTTCGACCGTCTGATATTAATGTATTCATTCTCCTCCATTACCAAGCGTAGGCATCTGGAAAAGCAACACAACTCTGCCGAATCGAACCCCGTTGAACGTGAGCGCATCCTAACGCAGATCATTGTAGAACAGCTGAACAGAGCTCTGCTGCAGTCGCTCAGCGAGGAGTACAAGCACCTGGATGAGCTCGATGTCGACTACAATCCACGCCACGAAGCGTTCTGGGCCGTTGGCGGCGTAGATCCTCCCAAGAACGTGCAGAAATCGAAGAAGGGCCGGGAATGGCAAAAGGATATGGCAAACGAGAGCGTTGATCGGATGGTTCAGTATACGGGAGCGCCGTATCTTGCCCTACGCCATCGCAAGCAATTGACGCCGTGGAAAACGGAAGCGGAAAGCGAAAACCTCGAGCTGAGCAAACAGCTGCCCCGTTTCAAGCACGACCCGCGAACCCTCGGCTACAGCACCAAGCATCAGCACGCCACCAATGTGCCAGGCTATTGGCCCAAAGGAAATGAGAATAACTTCGGCCTGCTCTCATTTCAATCGCGTGCACACCTGCAGATCCGTCCGAAATCGTTCGGCGAGCAGGATCAGCTGGAGGCATTGCATTCGCTGGCGATTAAATCGTCATACGCCTGGCTTTTGGCCCAGGCGAACTACAATGGCTTCAACACCTACAACGAACTGACCTATCCCATGAACACTCAAACTGTGATCACGAACGGCAGGGAATGGAGCTTTTATGAGTATCAGCTTAATACGCTGCTGCTGCACGGCACAAACGTGGCGGAAAATCCCCGTGTCAACTTCTGTCGCGGTACAAAGCCACTTCCACTGTACGCCGAGATTTCGGCAAGCGGCAAGTGCGTTGATTTCAACGATAACGCACTGCGGCACCTGCTCAATTTCTATGCCAATGCGCCATCGATTCAGCGGAGCATTGGGGAGCAGCAGCCGTATGTTGCCTCCGACGTTTCCGCCTATGAGAACGCCGAACAGCGTGACTTTATCAATAAGACCTTCAAATATTTGGCATCAAACCGACCGCGACACTTGGAGCTGCCCGAAATCTACCTGTGGGAGAAGCTATACAAGATCGATAACAACAATCGTGCCATGGAGGCTAAGAGACGCTTCTTCGAGCTGGACATCAATCCTTGGCAGCGA


Search Again