CR00497

CRIMIC CR00497

Gene Uba5

CG1749

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78928

Images

Construct Sequences

sgRNA sequence
CATATTTGGAGTGCTAGCTGTGG

Amplicon 5' Amplicon 3'
GCCATCACTAACATGCAGCGTTGCCCCATCCCATCTAACGCAAGTACCAAACTAATTTGGCCATCTGGCAGCACTGGTCAAAAGTGACACGGCGACAACCAGCTTAAAAGCGAAAGTTAACAATTAACAATTGCTGGCGTCCATAGCCAAACACACGAGCCAGAAACTGGAGCCACCCCAAAGCCAGAATGTCGCACGCCATCGACGAACTGCAGGCGATCATCGCCGATCTGAAGACGGAGCTGGAGACGGAGCCGAAATCCAGTGGCGGCGTCGCTAGCAACAGCCGCCTGGCACGCGATCGCATCGATCGCATGTCCGCCGAGGTGGTGGACTCCAATCCGTACAGCCGCCTGATGGCCCTGCAGCGGATGAACATCGTCAAGGACTACGAGCGCATTCGCTACAAGGCGGTGGCCATTGTGGGCGTGGGCGGCGTGGGAAGCGTCACCGCCGACATGCTTACACGGTGCGTGCACAACAAGAAGAGAAGGGCAACAGTCATTGTG CACCACAGCTAGCACTCCAAATATGTTGTCTTTAATTAAAGGCTATGTATTAATCAATTGATTTCCTGCAGCTGCGGCATTGGCAAACTGATACTCTTCGACTACGACAAAGTGGAGCTGGCCAACATGAACAGACTGTTCTTTACGCCCGATCAGGCGGGCCTCTCCAAAGTTGCGGCCGCCGCCGCTACCCTGAGCTTTATCAATCCGGACGTGGAGATTGAGACGCACAACTACAATATTACAACGGTGGAGAACTTTGATCGCTTCCTGGACACAATATCGCAGGGCGGACGGATAGCTGGCCAGCCGGTGGATCTGGTGCTCAGCTGTGTGGACAATTTTGAGGCACGAATGGCAATCAATGCAGCGTGCAATGAACGCAATCTCAACTGGTTTGAGTCGGGAGTTTCGGAAAATGCCGTCTCGGGGCACATTCAGTTTATCCGTCCTGGCGATACCGCCTGTTTCGCTTGTGCACCACCCTTGGTGGTGGCCGAGAACATCGACGAGAAGACGCTGA


Search Again