CR00496

CRIMIC CR00496

Gene Hlc

CG1666

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78927

Images

Construct Sequences

sgRNA sequence
GCAACTAATCTTCTCGCTGACGG

Amplicon 5' Amplicon 3'
TCGCGTTTGTTCTCCTCGAAAAATGCCTTTAGTTTCTCGCAGTTGAGGATCTCTATCTTTATCTCTCGAATTCGAGTGTCGTGAACAGCTACGCGAGTTGCGGCCCGCCAGCAATCCTGAGCACGATAACGGAAGGACTCAACTTCTTCCATTTTAAACTGGTAGTTCCTGAAGTGATGGCACACTTAGCAATATTACAATTTTGAAGATGTTATTCTATACTCACTTGATGATCTGTTCGCCCTCTTGGGCTGCAAAACTATCGCACAGTTTCTTCTCAACTGAATCGTTTACCTTGGACTCCTTCATGCTGACAAAGGACAAGACGGAGCCCTTGTTATTTCCTCTAGCCGTCCTGCCAGCCCGATGGATATAAGACGTGACATCCCTGGGGAAGTCGAAGTTGATTACGTTGTTCACGCACTGAAAGTCAATGCCGCGGGAAGCACTCGACTCCATGTCGCCGCTTCGAGGAGATTTTCGGTTAGTCGCTGATTTGCCTCCTGGCTTTTCCATATGATGTTCGTCGGAGGCAATGATTATGTCGTAGGTGCCCTTGTTGAACTGGCTAATTGTGTGGATGCGAATGTTGGCAGGCAGCTCGGAGTTCAAGACACAGGCACGGATGCCGAACTGCTCTAGGAACAATCGAACCCTGAAACATTTAAATGGGTAATAATTAGAACGAATTATAGTAAGTATTTAGGGGCGGATGGGAATG GCCGTCAGCGAGAAGATTAGTTGCTGGTCATGCGTGCGCCAACTGTTGCCAGCTGCCCACTCCCTGCATTTGTGGTTTAATCATCATTGGCTCCTGTGCATCTAAGGCGGGATTCGTATGGTTTACTCACTTGTAACACCGATCGATGCTGTTCACAAAGATTATGCTCTTGCCGCGTATGAGTCTCAGCTTCAATAAGGCGTACAAGATAGCCGGTTTATCGTTTTCCTCAGCCAGAATGCGCTGGTGCGACAACTGATCTTGCGGCACCAACTCCGGCTCCTCGAGTTTAAGCGTAACCGGGTTGTTCAGGCACAGGCCTTTCATGCGCACCACATCGTCGGTTAGAGTAGCGGAGACTAGGACAGCCTGGTAGATGGGAGGCAGGTGCTTAATCAACCGCTTGAAGTCCTTTTCGTAGCCATAGGCAAACACCAGATCCGCCTCGTCCACCACCAAGGTCTCCACATGCTTCAGATCCACCACGCTACCAGCCTCGGCGTAGGCCAGCAAATTGGCGGGTGTGGCAACCACAATGTCGGGACTTTCAGACAAGGCGTGCCGCTGGGTCACCGTGTCGTTGGAGCTATCGGCAATGTCCGCCACGCGTACAACCTTGCCGCAGGACTCGACCAGCTGCTCGATCACCTTACGGGACTGCCGGCATAGCTCCTTGGTGGGCGCCAGGACCACAGCGCTCACATACT


Search Again