CR00494

CRIMIC CR00494

Gene l(2)gd1

CG4713

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK no band79273

Images

Construct Sequences

sgRNA sequence
GATCAATGGGTAGACACATACGG

Amplicon 5' Amplicon 3'
CAGAGACACCAGCAGTCCTGACTACGATGAACGCTTCAAGGTTGACATCCAGCGGACCAATCGTCAGTTCCAGAGAATCTTTAAGCGGCATGGCGTCAAGTTTGAAATATACTCTAGAGGGTAAGTTGCCCGTACATAAAAGAACTGAGCTAGAACAATTATTTAATCCGTACTAAGAAGCTTTCCATGCATATTAATCTCAACTAACGGAGGCGGTATATGATCTTATTTACGCGTATTAATTTTCCAAGGAATACTTAGTAATATCCGATGAGTAGTAATCTTCTACATTTTGAAATAGCCTTAAAGACTTAAATAAAAATATATATATAATTTTAAAAAATATTTGGCATAGATCATTTTGCGAAAATTTAAAAAGCTGTTGATTGAGCTGCATACCTACTAAATATTTTTATCCAATTTGTAGGTTTCGCTTGGGTATTAATTTGCTCTTAATATTAAGTTTCAGCTCTTAATTTGAATTATTAAATTTTTCCCGTAGTAAGCATGTTCCTTTGGTCCCGTAAAACAGTATCGTACGAGTCACGGCTTCAAGCACACAT TCACCGTATGTGTCTACCCATTGATCTTCTTGATTGATTCTCACAAGGAACATTTTAATGAAATATTTTTACAAATTTTTACGCCTCAATTCCCAACAATTCAAACAAAAAATAAATGTCATCCAATGCTACGCATTTAATATAAATAGCTGCAGTATAGATTGTTGTGGACTAAGTCGTAAACTGCCCCTGTGTTGTTTCAGAGGTTTTCTGCGATCGGATACGTTGATCGGAACCGTAAATGTCAAGCTGCAGCCATTGGAGACCAAGTGCGAGATACACGACACATATGATGTAAGTGATAACTACTATAATAAAATAATATAAACTTAAATTTAACCTATGTATTCCTTAAAACAGCTAATGGATGGTCGCAAGCAAGTAGGTGGAAAATTGGAAGTCAAGATACGCGTTCGCAATCCTATTCTCACCAAGCAAATGGAGCACATCACCGAAAAGTGGTTGGTCTTGGATGCCTAGGGCTAAACAAGAAAATTTAAATAAAATAGGAACGCGTCCCCTTGCGATTGTTCTCGATTAAGTCACTAAGTTATTTGTTTGTAAATATCCCTCACAGAAAATTCAATTTATCTAAGTATGTACGCTTTTGCCGATTCCTTCGCAGGAAGAAGGCATTTATATATTACGAACACAACACATATAATGTACTATAAATATCTTTATATATAAATAATATATGTATATATGATATTGCCGGCGTTAAGGCGAAGGCGCAAGTCCAGAAGATTGTGCCGGTGAAGTCAGTCCATTCCAAGAGAGACAGATTGAGAGTAGGATCGGTCCACTAGCGCCTAGCCGAAACCTGATTATGTTAGCTTTCACATTGCATAAATATTTTCTTTTGATTTATAAACTGTTTGTTGAACTACAACTCCAGATATTCGACTATTTGTGAGTAGGGACTGGTTTCATTAAACACATCCACACCGCGAACTTTATAGAAACCTGCCGACAAAAAAAGATTTCGGTTATGAAAGATGGAAATTTTGCAGGTTATGCTCACCATTGACGGATCC


Search Again