CR00493

CRIMIC CR00493

Gene Cbl

CG7037

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79272

Images

Construct Sequences

sgRNA sequence
GCGCATAAACATTTGTACCCTGG

Amplicon 5' Amplicon 3'
ACGCCAGGTGCAAGGATAAAGCCGTGAGGATCGGGCACCCAATCGGATAGATCGCGTTTGGTTAGCTTGTGGGGGAAAATCGTACTTAAGTCACCACTACTACTACACACGGGCACCACCAGCAACACCAACAACAACAACAACGAGAACAGCACCAGCAACAACAACAACAGCAGCAAGAAGGAGAAGAGCTGAGAAGAGGAAGCAGAGGCAGCGCAGTCGGCAGCGCAGCGGCAGAGAGAAAAGATGGCGACGAGAGGCAGTGGAACCCGTGTGCAATCGCAGCCAAAGATTTTCCCATCGCTGCTTTCCAAGCTGCACGGCGCTATCTCGGAAGCCTGCGTCTCGCAGCGTCTGTCCACCGACAAGAAGACGCTGGAGAAGACCTGGAAGTTGATGGACAAGGTGGTCAAACTGTGCCAGCAGCCGAAGATGAATCTTAAGAATAGTCCACCGTTTATTTTGGACATCCTGCCGGATACGTACCAGCGCCTGAGATTGATCTACTCAAAGAACGAGGACCAGATGCACCTGCTCCATGCCAACGAGCACTTCAACGTGTTCATCAACAACCTGATGCGAAAGTGCAAGCAGGCCATCAAGTTGTTCAAGGAGGGCAAGGAGAAGATGTTCGACGAGAACTCCCACTACCGCCGCAATCTCACCAAGCTCAGCCTGGTCTTCTCCCACATGCTCAGCGAACTGAAGGCCATATTCCCCAACGGTGTCTTTGCCGGGGATCAATTTCGGATCACCAAAGCGGATGCGGCTGACTTTTGGAAGAGCAACTTCGGTAACAGGTGAGTGGCGCCTATTGGAAACCTATTGGACAGTGAAATATCGTGACCATAACAATGCCAAGTCTAATTGGTATTATTGGTAACTAAATGAATTTAAAGTGCGGTTTCAAAACCAAGTGTTATAATTCAATTCATTCATTGTGATTTGATATGGATAATATTACTAGAATTATAACTCTGAATATCCAATTTCGTGTCTGAATCAAACCAGTTTCAACCGGTTCGGTCTTAGCGCAGCTACCCCAG CCCAGGGTACAAATGTTTATGCGCATATTTTCAATTTAAAAGGACAATTCTACAAAATGGATATCACATATGTTGTTAACAAAGACCACACATTATATATTTTGAGTTTTCTTCTCGGGTTTCCAAGCTGTTCAAACATATATGATTGTGAACTCCCTTCCCAAGTAATTTATAAGAAGGTCTTTTTGTGTTACATTCGAATTCCCCTAAATAAACTTTATAACTCCGCATTCTAACAAAGAATATATTTGTGCCAAAGCAAAATAATAGCACATACTGACATTTTTGCCTTCCTATTGCAGCACATTGGTTCCCTGGAAAATCTTCCGGCAGGAGCTTAACAAAGTACATCCCATAATCTCCGGCCTGGAGGCCATGGCCCTAAAGACCACTATCGATCTTACCTGCAACGACTTCATTTCCAACTTCGAGTTCGACGTCTTCACACGCCTCTTCCAGCCTTGGGTGACCCTGCTACGCAACTGGCAGATTCTGGCCGTCACACATCCGGGCTACGTGGCGTTTCTCACATACGACGAGGTGAAGGCTCGCCTACAGCGCTACATCCTCAAGGCGGGCAGCTACGTTTTCCGGCTCTCCTGCACGCGATTGGGCCAATGGGCCATCGGCTACGTAACTGCCGAGGGAGAGATTCT


Search Again