CR00492

CRIMIC CR00492

Gene Utx

CG5640

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78926

Images

Construct Sequences

sgRNA sequence
ACTTGATAATTCAATGTATGAGG

Amplicon 5' Amplicon 3'
TCTGCGCTGTTTGTTGTTGGCGAGAGTTCATTTCTAATGATATTGGCAGGTTCCAAGCTTCTTCGATTGAACACAGCTGGCGGCGCTTGGATGTAATACTTGGCAATGGTGCTTGACTGAGCTGGCCCTCCAGGAAAGTGATTCTCTGAGACAGGCCTTTCGACAGTCCAATTGTGTCCTTTTTCATACGTATTGCTTGTTTTTTTCGAATTAACGAAGACTTCTTCAAGCAAAACAAGTGTGTTAGGTATTGGAAATGGCTACAATTGCATATATAAATTTACCTGGAATGATATTTGTTTGGTTGCATTTAAGTAGCAAGCATAGGCATCTCGTAATTGACCACAGCTCTCATAAAGTATACCCAGGTTGGTCCACGCGGCTTTATGGTCTTTATCCAGTTGCACAGCACATATGTAGGCTTGAAGGGCATCCGTGGGTTGATTTTGTTGCTGATATAAGACGCTAGAAGTGCATGTGTAGAATACAAATAAGATAGGGGCCAAGCTAAACACATTCATTGTTATTTTACCCGATTGAGCACCAAGTATCAGCATTCCCCTCACTTTTTTCCACCGAGTTGCGATATGCTAGGAAAGCATCATGAACCTTATTGATGCCGGCGTAACACCTTCCTAGTAAATATAATGATTGTCCACTCTTTGGGTCAGCTTCGATTGATTTTTGTAGAAAATTTAATGCGTTTGCTTCACGTTCCTTTTTTTCGCCTAGGCATTCTACGCAATGGTACATCCATCCTATAAGGATTCAATAAAAAGTTATGTCTCTACCAGCTTAAAATATAACTTTTTAACTTACCTAATTGTCGATAAACATCTGCTTTGAGCTCCAAGGAGATGTTTTTCTCATTTAGAAGAAATTCGTAGCCATCCTTTGCCGCCTTGTGCTTGTTTTGAACTTCGTACAAATGCGCGATTTGAAATTTGACTGCAAAGTATTAATAATGAATAAAGTTTAAGACACGGGGTGAACGTACTGCAAAATATTTAAATTCTGAATGAATCATAGAAGTTTGCCTTCATCGTATTACTTGA GAGGACTTTTTGCATATAAGTTGTTTATATATCAATAATAAGATAACATTTTAAGATGATAAGTAAATAACTGAAGAACAGAAAAACCTTTTCAGATCACAGTTTTAATTACACATGAAACTTATATGCAAAAGTTTATAATTATTCAATAGATCTTACCCTGAAGTTCCGAAAAGGTCGAAGGATATGTATAAAGCAGCGCCAATTGTAAATGTTTTAGGGCAATATGGAACTCCCCGCAGTGTTTTAGCATAAGACCTAGACGCAAATGAACTTCATTTGCACATGTAAAATTGGGACTTAGGTATAAAAGCTCCTGAAACGATTTGATGGCCCTGGAAAAAAGTAAGTAAATTAATTTTTTTATTCGTTGTTCTGAATTATTTGTTATAACTTGAATGTATTATTTTAATTTATTAAATTTTGTTTTATATTTAATTTATAGTAATTGTTTACAGTGAGCGGTGTTTACATAAGTGCATACATACTTATGTGCATGCAGTCACGTACACAC


Search Again