CR00491

CRIMIC CR00491

Gene Topors

CG15104

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78925

Images

Construct Sequences

sgRNA sequence
TAACACCACACATTCTGAACAGG

Amplicon 5' Amplicon 3'
GCTCACAAACGGTTGCCATTAACCTGAGCATGAGGCGCCCAGCGGCGGTTGCCAGCGAGGAACCAGAGGTCATCGAGATCGACGACGGCGATGCGGCCGCAAATGCAGAGGTGGCGGCCATCAATGATGGCAGCAACACCAGTAGGAGACACGCAGGTGCTACTCTTCCAGTGACGGCGCACATCGAACTGGAGAGCAGCAGCAGTTCCGGCGATGAGGATGAGTGCGTCTTTGTGCTGGAGCTGAAGCCACCACACATGCGCACTCCCGAACAGGTGAGCCTTGACTCAAATAGTGACTCCGATGTGGTGTTCGTAAATGAGCAGCACGAAGCTGCGCCGGACGCAATTGCCGAAAACCGGTCGACACAATCCCCTTTGGATCTGGCCTCCAGGGATCAGGGCCTGTTTATGGGGCCCAGCACAAGTGGCGCAGCGGCCAACAGAGGCAAGAACTGGAAGCTGGTCATGGCGCAGACACGGCGCCTCGATCAGTTGCGCACGCTGCGCTCTATACGTTCGAAGAAATCACGCCGTTCATCCATGCCTGCCCGCAGTGACAGTGGCAGCAGCCCCAGCAGCTGCAGCAGCTCCTCCTTTCACTTCAGCAGCAGCAGCGATGAGGATAGCAGTGACAGTAGTACCACCAACTCCGAGCCACCCAAGAAAAAGTCACGCAAGCGAGTGGCGAATAATAAGCGCTCTAAAAAGGAGTCAATCGGGAAAAGGACATCTCGTAAACGGAAGGCCAAAGACCAGAATATGGAAATGCTTGAGCAGCAGCAGATAAGCCAAAAGAAGCCCCAGCGCCAACCGGAAAGCAGCAGTGACAGTCCAAGTTCGTCCGATGACGAGTCAGGTGGCGATAGCAGCGAGTCATCCGGTAAGTGGTTTGTGAATCTAGACGGTTCTTATCAGCATGTATGAATGTATGTATAACACCACACATTCTG CAGGAAAACACTAGAATGATCTCTAAAAACAATCAAAAAACTATTTATTATCCTATCAGATCAAACTTGTATAATTACACAAATTTGTTTTCTAGGTCAACCCAACACGAACAACAACAAATCCAGCAGCGATTCCGATGATGATAGCGCTGTAAACATGCAGCTCAGTGCCTTGCGCGCCACACTAAAAGCGGAGGCAACTCTGGAGGATAGGAAACCTGTAAAACTGGAGCTTCAGTTGCCGGATGACGACCAGGCGGGGCCCCTCCACTCACGGATGACTCCATCGCCGAGAGAGGATAACGAACCGGGTTGCAGTGCACCGAAACGGCGACGCAGTTGCAGCCACAGCAATCAGTCCAGCCAGAGTGCCAGTTTGGCCAGCAGTTCGACAGCCACCTCGAGCTCGGCTCCATTAAGTTCGTTTGCCTGGGGAGCAGCGGGCTTTTCCGGCGATCCGCTGATGCGCGGACATCCGGCGATGGAAGAGCACGACATAGCCAACTCCCTAATCGAACTGTCCACTCTAACGCAGCCTGTGAACATCGGACTCTTCAACGAGCATTATAATTCGGCAGAGAATTCCATGGGCATGCTGAGCAACACGTTGTGCGACAGCCCACAAACTTTGG


Search Again