CR00490

CRIMIC CR00490

Gene CG3689

CG3689

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATATAAAGTACATGGAGAGATGG

Amplicon 5' Amplicon 3'
GGTAGAAAGTCGGCCAGCTTGTCCCGCAAATTTTCCCACAGGGGTGTGTGTATAACAAAATGGCGTCCTCGCAAGTCTCAAACAAATCGGGCTCCGGTTGGCCGCGCCGCGGAAGCCAAGGCCAAGCGGATGCAGCCAGCAGCAATAACAACGGTACCCAGAAGTACACCAACCAGGCGCTAACCATCAATCGCACCATCAACTTGTGGGTACAACACATTTCATTCATAGACGCACATCATAGATCGATCGATTGTTTCAGATACCCCCTTACGAACTACACATTCGGCACCAAGGAGCCGCTCTTTGAGAAGGATCCGTCGGTGCCATCCCGATTCCAGCGGATGCGCGAGGAATTCGACCGGATCGGAATGCGGCGCTCCGTCGAGGGAGTGCTTCTGGTCCACGAGCACGGACTGCCACATGTCTTGCTCCTGCAGCTGGGCACCACGTTCTTCAAATTGCCCGGTGGCGAGCTAAACGCCGGCGAGGATGAGGTCGAGGGCCTCAAGAGATTGCTATCCGAGGTAAGTCAAACGTGGCGCCATAGTTAAATATTGTTATTTGATCTTAACTATCACTACTTTTATTATTTCGTAGACGCTGGGTCGTCAGGACGGCGTAAAGCAGGAGTGGATTGTTGAGGACACGATTGGGAACTGGTGGCGGCCGAACTTTGAGCCACCGCAATATCCATACATTCCGCCGCACATCACCAAGCCCAAGGAGCACAAGCGGCTTTTCCTCGTCCAGCTACATGAAAAGGGTAAATATCCGCAGGGCGTTTTGTAAGTCCCTACGCGTAGGTATAACGAGCACACCGTGTATCCAGAA GAATATCCATCTCTCCATGTACTTTATATAACCTATAGATTGTTTTTGTTTGCCAAAAACCGAATACGCTAACAAACCTCATGTCATATCTTTTCAATGCTGTTTAGATACGGACGGGAACGCCAGTTACGATGTACCCTGAGCAGTTCCATTAGCGCCGTGTGTGTCGTATCTACCCAACTCTAATCTCAAGAGTGCAATGCCATAGAACAACAAATCGAGCAAACAGAACAGATCAAACAGAAAAGAAACAAACAGATCGCAAAAGCTGGCGCAGGCGACTCCTTAGTTAGTTTTGATTCTAGTCCAATTGTACAACATGTCGAAAATCAAATTCAAATTGTATTTTTGCTCAGGACTGAGTGTTGGCATATTTTGTTATTTCCCGATTTTTATCATTCGAAATTCAAAGATTGTTCTTGTACTTAATTTTGTAAATATGTCGACATACTTGTGAGACTGAGCGCAGCAATGTTATCCTTCTATTTACATATTTTATTTATTTCCTAGCTTCTATTCTTACTTTTGTGAAGTGTCATGTGTCGTTCATCTTAAGGTTGTTGTGTATTTATCGAAAGCAATCCAATCCATCGGGCAGGCAGCAGAAGAGCATTGTAACGTTGCTGGCTGTCGCAGTCATGTGCCCAAATCTCGCGTGTTTT


Search Again