CR00487

CRIMIC CR00487

Gene CG3328

CG3328

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78924

Images

Construct Sequences

sgRNA sequence
GTGGCTACTTGAGAGCCAATGGG

Amplicon 5' Amplicon 3'
AACTCCAAGCCCTGAAGACGATGATCCGCTGCTGGGGTCCCGCCGATCCAAGGGCACCCGTTTTCATTCCGAGCAATTAGATTTCGTTTTTATCGCTTGGTTACCATGCCGATCCGTTCGCAGTGGACTCCATCGTTTGATTATTAGTTTTACGGCCCGTTTCGGGCATTATTTTCGCTGCTCAGCCAGTTGTGAAGAGTGCATCAACCGTATGCTCGCTCATACGTGCGTTAGATAATTGTTCCATCGGATGCAGTGGATCGCAGCCGCAGCAGCAGCCGCAACAGCAACAGAAGCATCAAAGTCGAATTGGGCATCCCATGGTGTGCGCATGGATGCTGGCAGTTAGAGCCAGCTAACTTGGCCCACAGTTCGGACTAAATCGAAGAATCCTGCAAACACAACCCCCCACTGGCTATGGACTATCCCAAGAACTTGAGCGGTAACTCATCAACATAATCATGAGCATAGCATAATAATCCGAGTCCCCCCATCCGCGGCACCTGCATAAATTACACAACTCACTTGGGGCACCAGTCAACAATCCGTTTGGCCAATTATCGATCAAACACAGAGCGGGAATTTCAGGGCTTATCAGCGGCAGCTCCCCGCTTCCAGTGGCCCGAATAAAACGAATATTTTGATTCAACTATAATTATCTGCGGGCTGGTAGACGCCCCCTCAGCAACGTGCCACACTTAATTTCCCCATAATTGAAATGTTTTTCTGCCATTCTGATTTGCAGTCCGAGTAGCGGGCGATTCCCGGACTTTGCTCTACTTCGAAAGATAATAAACTGTTGGATGTCAATATTTACTCCTTACCCCCGTTCCTCTGGATACAGAATTTGTATATTTCCCCGGAACGAAGGTG CAAGTGGCCGTACCTACCACGTAGTCTTGTAAAATTAAACCACCAACTATAACTATTACAACTGAGCTCCATATTCAGAACCATCCAGATTCGCTTGGATTTCAATGTTTCCTTTGCACACAAACTTGAGATGAAGGGAACATTACGATACACTTGAATAAATTTGTACCGCCTTTTGAACTAACCACCATGTCTTACACTGTTGCAGCTCCCCAAGATCTGGATGACATAAACAGCGATGGCATGGACCATCTGGATCTGCTGGTGCAGGGGGCTTTCGACGATGGCATCCAGCTAGGCCACAATGGCCACCTGTCCGCTGGAGGAGGAGTGCACTCACACATGGAGTCGCCGCACACGTCGCCCATGAACGGCTTGGATGCCCACCTGACCAACTCCGGCCGCGTGGGCAGCACGCCCGTGGCGGCACAGGCCCAGAGCCACGTGCATCCGCAGCTGCCGGAGAGTCCGCCGGATTCGCAGCCCGCCTACAGTCCGCTGGGCGAGGCCCACGGGATGGCGATGCCGCTCCAGCGAGAGCTAATCTATCCGGGTCTGGCGCCCATGCAGCACCAGGCCAATATGCTGCAGACGGATCTGGGCCAGTACGCCTCCCCTCCGCAGCAGCAACACCACTTTGCAGCTCCGCAGGCCGATGTGCGGATCAAGCACGAGTCCGAGCTCATCATCAACCCGA


Search Again