CR00486

CRIMIC CR00486

Gene Zpr1

CG9060

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATGTGACTCAATGGTTCTTTTGG

Amplicon 5' Amplicon 3'
CAAGGAATCGCTGCATCTGCTGCTTGGTCGCGTCGTCGGCGGAGTCGTGGAAAAGCGTGCCGTCCAACTGATCCCGCATGGCAACCAGCAGACCCTCCACGGTGGTGAATCGCCCGCACAGGGCATGCGGACCCACCTCGAGGTCCAGCTCTGGAATAGACATGCTGCACGTCTCCGACTTGAGGACATCACGCGTCAGATCCTCCCTGCTGGCAATCTGGACGCGGAAGCGTACACCCTGCGCCTCCACTCCGCCGCCGGACTTCACTTCGTTCGTCTTGTGGCCACAGGCACCGCAAACGGTGGCCATGATCACCACCTCCTTGAAGTGCGGTATGTTTGTCAGCTTCATGTTCGTCTCGCAGGGCGCCTGGCAGCTGGGACAATTGGTGGGGAACTGAAGCACTTCGCCGTGCAGATTCTCAATGGGCCACGAGTCCTCGGCAATCGGCTTCAACAAGTGCTGCTCCTCGTGATTCTGCTCGTACAGGCCTGTAAAGGAATACAGGTGTGTGGTTATAAGGGGAACAATACGAATTATGTGACT TGGCTATCTCCACTGGTTAAGTTTCTAATTTTACAAAGAGGCCTCACCCAATTGCTCGTTCTGCTGCTGGCTGCGTGTGAAGTACGAAGTCTTTAGCTGCGGATCGGCGGCAGGTGCCAGGGGATTCTCGATGAAACTATTGCCGGATATGTCCTCGAGAAGCACTTGAAAGGGTGTTGTCACCTCCTTTAGGCGGTGCAATCGCTCGATGTACTTTTCAATTGAAGCAGCTGTCTCCGGATGATCGATGCGCCGCTTCTCCTGATCCTGCGACAAGCCGGCTATCGTCCGCTCGATGATGCCTTCGACGGTGGTCACCTCGCCCTTCTGCGACTGCACCGGAATCTCTAGCTCGATCTCCGGTATGCTGATGCTGGAGTTATCCGAGCGCACCACGCGCCGATTGAGATCAGCCACGGATTGCACTCGCAGTTCGATGCGAATGCCGGACTTTTGGATCTCCGATGCCGACTGCATCTCGTTGTTGATGTGGCCGCAGTGGTCGCACTTGAAGGACATGAGCACCACCTCGCGAAAAAAGGGTATCTTGGTGGGCAGCAGCCGAGTGACTCCCGTTTCGAAGCAGTTCATGCAGGCGGATTCGACCTCCACTATCTCGTCGGTCTGC


Search Again