CR00485

CRIMIC CR00485

Gene dpr4

CG33512

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79271

Images

Construct Sequences

sgRNA sequence
TTATGCGAGATGCGATTAAGAGG

Amplicon 5' Amplicon 3'
CGTCTACGGTTGGATCTCCGGGGGATACGGGGCAAGACACGGACAACGTAAAATTTATTACACCGCATAATTGCACAGCCACAGAGCGCTTGCTTGGGACAAAAGGTTGAGCAGGCAGTTAGGTGGTGGTAGGGCGGGGCTGGCTTATGGGTCAGGGGTCAAAGGGCAGAGAGCTGAGGGCTGAGGGCTGAGGGCGGTTCGGGGCCCAGTGTTGTTGCATTGCTAACAAATCGCTCGTAGCGGAAGCGAAGCCGTGTTACAAATGTGCAAACCAGAGCGAGCCAAACACAAAGTGCTATTGGGCGTTGGGATGGGGCGCGTGGAGCGCATGAAGCGCATTCAACCCACAGACATTCGGGTATGGGTGTAGCCACCACCACCACAATGGTGGGTCTGTCGGGTCCAACCGCCAACTTTATGGCGTAATCTTTTAAAAGTAATCTACAAATCTGCCACACGACCGCCGCAGGTCTTTTGTTTTGCTGTATGCCTTATGCCTTATGCAAATATAATGCTGGGGAAACCTTTGGGGCGCATGGCGCATTAATTGCTAGCTGCTCCGCAGCCGTTCCTGACCCCCAACACTTACCGCTCGATCGCCCAGATTCCGGACGCGGCAGTGCAGCAGGGCCGCCTGGCCGACGGTTGCGGTGACCTCACGCCTCGAGGAGTTGTCGAAGTACGGCTGCGAGTACGGGGTTTCCCAGTAATGCGGCGGCACCTCGCCACCGACCATGCCGCAATCTGTGAATGAACAAACAGTGGATGCAGACCCATTAATACCTATCCATGTGTATGTGTATTTAAATGGGGCGGAGGGGTGTAAGAATATCACTTAAATTGCCCATCAATTATGCACGTTTGCTGGCGGAAGAAGGTCGTTTTTCATTTTTGAAACAAATAAAAGCTCTCCAACGAAACGTATTCTATTTGGGGCCTTAAATTACCTAGGCGAGATTTATGCGAGATGCG GCTGAAAGCGTCTTTTGGCTTAAATCAAGCCTATCATATCGGTTCTTGTCATCAGTGTCAATGGGCTTAATTAAAATAGATGTGCAATCGACCATTGACACATTGACAAATTCGAATGATCTTGAATGCTTAAATAGCATATTTAACTTTAATTTCCGCTTGCTGATATAAACTACTTTAGTTGTTAATAAACTTATAGGAACATAGTAATACCTCTTTTATTACAAAATGAATAGGACAGTGAAGAGCACTTAAAAGCCTGTACATTTTTAAACTAACTACATTCACTCTCAGCGATTTATGAGGCTATAAACCGTCTGCGGCTTTGATCCTTTTTCCTTTTGCATTGCCTATTACTGAACAGATTACACCTACATTTTTTCGCCGTGCAATTTCATGGAGGAATACCCACCGAGGAAGAGGAGCAGCCACAGCGGCACCAAGCAAATCGCTTTCAACGCTCTCGGGCAGTCCGTTGTCCACATGTTTTATGCTCTCCACTCGGACTGCTACTACGGCTGCTAGCTACTTCGAT


Search Again