CR00484

CRIMIC CR00484

Gene CG6543

CG6543

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79270

Images

Construct Sequences

sgRNA sequence
TGCCCAGCTCCAACCTAAGCCGG

Amplicon 5' Amplicon 3'
CTCCTTGCGATCGGCCTATTGGATGAAAGAAAATACAAGAGATTAAATAGTGTTAAGCAGATATTTAAACTTGAACTAACCGTGGAGAACGTGGCATGGAAGGTGCGACGCTCGAACTTCAGGCCCTCTTGGAGAGTGGTCTCGTAAGCCGTGTTAACCGCCTCCTTGCACAGCTGCACGATCAGATTGGAGTGGGTGCCGATCTTCTCGCCCAGCTTGACGGCCTCGCCCAATAACTGGTCGGCGGGCACCACCTTGCTGGCCAGACCCAGCTTCTCAGCCTCCTGGGCGCCGATCATATTGCCGGTGAGGCACATTTCCATGGCCTTGGACTTGCCAACGACGCGGGTCAGACGCTGGGTGCCACCGGCACCGGGAATGGTGCCCAGGGCAATTTCAGGCTGACCAAACTTGGCCTTGTCACCGGCATATATGATGTCGCACATCATGGCCAGCTCACAGCCACCGCCCAAGGCGTAACCATTCACGGCAGCAATGATGGGCTTCTGGGTGCGGGCCACCTCTGTCCAGTCGTTCAAGAAGTTGCCCTGGATGCACTGCGAGTAGGTGTTGCCCACCATCTCCTTAATATCAGCGCCAGCGGCGAAGGCCTTCTCGCTGCCCGTCAAAACGATGGCGGAGATGGTCTTATCCTTGCTGAATTGCTGCAATGCGGTGGACAGCTCCTTCATCAGGCCATTGCAGAGGGCATTCAGGGCCTTGGGGCGGTTCAGGGTGATCACGCCTACGTTCTTGCCCTCGCCGGCCACTTCGGTCTTGATGTACTCCCAGTTGTTGTTGGTGGCTGAAAAGAGATGGCATCATAAATGAGGTGATCGTATGTGCGCGAATGTTACGCAATCAATGTTTATTTGCCTGGAAAAGTACAAAAGATGTCGCCAAGAAACCGGCGGCACTTGATAT ATTCCGGCTTAGGTTGGAGCTGGGCATCAATCGCGTGGACTTTGATCCCTCGCAATCAACCATCTACTTACAGGAGCTGCTGAAACGGGTGGCCACCTGTGGCTGACGGGCGGCTGCCTGCAGGACGCACTGGGCGCGGCTAGCGAAGATCTTAGCAATGTTGGCCATTTTCAATTGAAGGAACTCTGAGCCGGCTGCAAGTGCAATTCGTTATCTAATCTGTGGCGGTATCTGGCATGGAGCCACTCTAGAACTTGGGATACTTACGCTGCGAAGCACTGGAGCAATATTGGCGCACTAGTGGGGCAGGTGTGACCGCGTTCGCTCCCACCAGAAATGCCACTATTTCCAGTCACTGTTTCAGTCACAGTTTGGGTCGCAGCAACAAGTGGTTCTAGCATTACAGCTGTTAACGCAAAAGTATTGTTAACAGCCGAAATTAAAATGTGCAACCTAATAACACAATTATTATGTTCTTAAATCTGTTTTAATATATTTACAATATAATACTACTTCTCACGTTTTACTCTAAAAATAAATATACATTCGTATTTAAGCTTTTAATTTTTATGGAGAACTTGAAATAACATTATTTACATAAGATAAGCCTAGATAGTTTGAAATTAACAGTACTTTTTATCAACAACTTGGCTGGTAAATAAGTAAGTATGCGTGATCACATGTTTAGCTTTGTAAAAATTAATTCCTAGACCTTTGGTATTGAAGATGTCTGGGGAAGATTACTGCTGGTCTCCACCAGCCAAATGTGCTCCTCTCGTTGCCTTCTTGAGCCATTTTCTCGACGCACCCGCCAAATTAGAAACACCAATACCACGATTAGGAAGCAGAATATTACTATAACCAAGCTGAAAACATACGCTTGGGGTGCTAAAAGTAAATAAATTAGTATTAATGAAGAAACTTTTGATAAATACACAACTTACTTTCACAGTAAGGAAACTTCCTAGCCCACAATGCGTCCTGGCAAATGTTCTGGTTCTCGCCTTTCAGTCTGTGCTCCGCCGGGCAGTCGTAGTAGATACGGGTGCCATTGGCTACCCTTGATCCTACAGTGAGGATTGCATCTGTGAAGTGCTTAACCATAACGTTTGGCAGTTGGGGAACCACGCACTCCCCGTTCTCCTGAAGA


Search Again