CR00483

CRIMIC CR00483

Gene Raf

CG2845

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band OK79269

Images

Construct Sequences

sgRNA sequence
AATAGCTTGGAGGTGGGCGTGGG

Amplicon 5' Amplicon 3'
AGTCAAGTCTGCGGGTTCTGCACTTACTTCAAAGATCGTGTTGAAATCGTTTTAAAATAATAATAATGGTTTCATTTATTTGTATCATTTCAAGCGACCAAAAGTGGCATTTAATACAAATTTCGCGCCTATGCACGCCATCTATTGGTGATTTGCCGGAACCCGACGCTTGTGTCGGGGCTGCCACTTGAATCAAACCCATCTATGTTTCTTCCATCACTACCACCTGCACTTGTATATGGTTAGTTGATTAATAGCACGTCAGAAACTAATTTACCTGTTGCCGCTCGTACCAGATCCAGATTTGTACTATCCCGAGAAGTTAAAAGCTCTAGGCAAATTAACAATTAGCCGCGACACAAACCCCGTTTCGCAGAGCACCTGATACCCTTTATCGTTATCGATTGGTACAGCCGAATCACGCCTCCTGATAACGATTAAACAAAAAGTCGAAATGTAGTAAAATTCGCGGAAAGTAAATAAATTGTTATAGCCAAGGTGAAATAACGAGCGGCCAGCTAGTGGCGATACTGATACTGTTGCGAACGTTGGGCAGCCACCGACGGTGCCGGCTGGTCAGGTTGTTATCGGGTAATTGGCAGCTCCTTTGGAAAATCCTCAAGTTCAGCTGCTTCTGCACACACTGACCTTCATTATACATACATACCGTATATACGAGCTGTTTGTGTGCGTGTGTGTGTGTGCGCTTGCAAGTGTGTGGGTGCACTGAAAAAAGGTTGGAAAGGATACAAGCCAGAAATCAGTGAAAACCGGGAATATTGCATCCCGGAGACGGCGGAAAAGCCGAAAAAGCCCATTAAAAGTCAAGGACGACATGCTGCCCTCCGCCCACAGAAGTGGATGTGGGTGGCTCACCCATTAGAACTCCACCAAAACGCAAGCGCAGGAGTTTTTCCTTCAAGAAGTCAAGGCTTCTTCGTTTTCGGGGTCATGGTCACAGCGCATAGTATATAGGATAAAGCAACACCATGTCCAGCGAGTCCTCCACCGAAGGCGACAGCGATCTATACGATCCTTTGGCCGAGGAGCTGCACAACGTCCAGTTGGTCAAACATGTGACCCGCGAGAATATTGATGCCCTGAATGCCAAGTTTGCCAACCTGCAGGAGCCACCAGCCATGTACTTAATAGGTGAGTCGTCGAAAGCCGAGCTGAACACTACCTGGG GAAATCCCACGCCCACCTCCAAGCTATTTATAAAATACCCGACATATGTGTATGTATGTATCTCACGACTTTGGTTCTTGCCCACAGAATACCAGGAGTTGACCTCCAAGCTCCACGAACTGGAGGCCAAGGAGCAGGAACTAATGGAGCGACTGAACTCGCAGGACCAGCAGGAGGACTCCTCCTTGGTCGAGCGGTTCAAGGAGCAGCCCCACTATCAAAATCAAACTCAAATCCTGCAGCAACAACGGCAATTGGCGCGAGTGCACCACGGCAACGATCTAACCGATAGCTTGGGCTCTCAGCCGGGCAGCCAATGTGGAACTTTGACCCGTCAGCCCAAGATCCTTTTGCGAGCCCACCTGCCCAATCAACAGCGCACTTCAGTGGAGGTAATTTCGGGAGTACGACTATGTGATGCCCTCATGAAGGCCCTGAAACTCCGGCAACTAACGCCGGATATGTGCGAAGTAAGCACAACTCATTCCGGAAGACATATCATACCCTGGCACACGGATATCGGCACTCTGCATGTGGAGGAGATCTTTGTCAGGCTGCTGGATAAGTTTCCCATTAGGACACACATCAAGCACCAGATCATACGGAAGACCTTCTTCTCGTTGGTATTCTGCGAGGGCTGTCGAAGGCTTCTGTTCACCGGGTTCTACTGTAGCCAGTGTAATTTTCGATTCCATCAGAGGTGTGCCAATAGAGTGCCGATGCTGTGCCAGCCCTTTCCCATGGATAGCTACTATCAGCTACTGCTGGCCGAGAATCCGGATAATGGCGTTGGTTTCCCCGGCAGAGGCACTGCTGTCCGCTTCAATATGAGCAGCCGGAGTCGCAGTCGTCGTTGCAGCAGCAGTGGCAGCAGCAGCAGCTCGAAGCCACCATCTTCATCCTCCGGCAATCATCGACAGGGTCGTCCGCCGAGGATCAGCCAAGACGATCGATCCAATTCCGCGCCAAATGTGTGCATCAACAACATTCGATCGGTCACAAGCGAAGTGCAGCGCAGTTTGATAATGCAGGCCAGACCTCCTTTGCCGGTGAGTCTAAATATTTGCTGTTCATATAATTTTGTGGCTTAACATATGTATGGATTTCTTACAGCATCCGTGCACAGATCACTCCAACTCCACGCA


Search Again