CR00481

CRIMIC CR00481

Gene CG17829

CG17829

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78923

Images

Construct Sequences

sgRNA sequence
GGCTATAGATATGGCAGCAAGGG

Amplicon 5' Amplicon 3'
GCTGTGCGTGTTATCGGAACTGGACATATATTTCAATTAATTGATGAAATTATAAGAACAAATTTATATGAAATTATAATTATGTTGTTTCTAAAAATCGCTTCTCGAAGCGAACTTAAAGTCATCCTTAACAGCAATGTGTACCAGCCAAAATAAAAAAATGTCGATTTTGTCGATGGAATTTTAATGACTTTTCGGAAAAAAAAACATAGATAAGTTGAAAAATATTAAACCACTAACTATTCAACTAATTCAAAAGGAAGAGGAATTTACCATCGATTTCTTGAGCGACCTTTACAAAAGCGATGTATCGATGAAAAATCGATTGGACCAGCTCGTCGATAAAGTTGTTGTTTGCTCCAGGTTTACTTTTAATTTCAAATTCAACTAATATCCGGGATTAAGAGTGTAAATCCTGTCAGGAAAACCATGCTAAGGCCCCAGTCATCAGTGCCTGCGCCTCAGCCGCCTGGCAAGCGAAAGAAGCCCGCGGAACTGGAACTGACCTGCGGATGGCGCGACTGCCAGGAGATCTGCACTGGCGAGTGGAGCCTGAACGGGCATATTGGGGATCATCTGGAGCACTATGCGAAGGCCCAGGACGATCGGGGGGCGCATGCGGAGCACACGGAGCATCAATGCACATGGAACTCCTGCGATTTCCGCACCGAAAACCAGGTGGAGTTTGAACGGCATTCGTACTACCACGGCTACTACTTGAACCTGCTCCTGCAGGGGAAGCTGGAGTGCGATCTGCATCCGGAAATCCCCGCCTGCACTGCTCCGGCCCGCCTCATGGAGAAGCTGCCCGCTCTGGGCCAGAACTTTCGATGTGGTTGGACCGACTGTGAGAGGGAGTTCGTTTCGATTGTGGAGTTCCAGGACCACATCGTTAAGCACGCCCTATTCGAGTACGACATACAGAAGACGCCGGAAGACGAGCGGCCCAAGACGATGTGCAACTGGGCCATGTGCCACAAGCACATGGGCAACAAGTACCGCCTCATCGAGCACATCAGTACCCACTCCAACAAGAAGCAGGTGGCTTGCTTCCACTGCGGCGAACTGTTCCGCACCAAGACTACGCTCTTTGATCACCTTAGACGCCAGCCGGAAAACAACAGTGAGTGCGAGACTTGCTCTTTAAAAACACAT AAACCCTTGCTGCCATATCTATAGCCATACGTTATTCCTGACAAAACCCGCAATGATTTAATTTAGTTTACTTAACTACTTGGCCACCCTCTAATCTGTTACAGCAAACAGCTTCCAGTGCGCCCAATGCTTCAAGTTCTTTGCCACCAAGAAGCTGCTGAAGAGCCACGTGGTGCGACACGTTAACTGCTACAAGTGCACCATGTGCGACATGACCTGCAGCTCGGCCAGCTCGCTGACCACCCACATTCGGTACCGCCACCTCAAGGACAAACCGCTCAAGTGTAGTGAGTGTGACACGCGCTGCGTTCGGGAGTCGGATCTGGCCAAGCACGTTCAGATTGTCCACTCGAAGACGGTGCACCAGTGCGAGCATCCCGACTGTCATTATTCTGTACGCACCTACACGCAGATGCGACGGGTAAGCCACCGTTCCCCAAAGCTGGATTCCTTTCTGCCATTCGCTCGACCGCAAGTAACCCTCCTGTTTCTCTTACAGCACTTCCTCGAGGTGCACGGCAACAATCCCATTCTGTACGCCTGCCACTGCTGCGAGCGCTTCTTCAAGAGCGGCAAGTCGCTCTCCGCTCACCTTATGAAGAAGCACGGCTTCCGCCTGCCTTCGGGCCACAAAAGATTCACCTACCGGGTGGACGAGAACGGGTTCTACCGCCTCGAGACGACGCGCCTCGAGAGCTTGGAGGTGACCCAGCAAATACTGTCGCCGCAGGTGAACGACTCGCTAGCGAAACCGGGCACAGGATCCTGCTACGAGATCGTGGATCCCACAAATACCGAGTTCGAGCGCAT


Search Again