CR00478

CRIMIC CR00478

Gene Su(var)3-3

CG17149

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band OK79268

Images

Construct Sequences

sgRNA sequence
GGGCTGTTGAAAGTCTTTCCAGG

Amplicon 5' Amplicon 3'
CAACCAGCGGAAACCCAAAGGCACGGATGGCGATCTGAAATACTGTTACCAAGAGTTTAACATTCGGAACACCCAGATCAAAATGGAGGAAACGATCAGTACGTTTCACGATCTCCATGCCGAGGAAAAGCAGATGTTAGCCAAACTCCACGAACTGGAGCAGAACCGACCTAGGTAAGTAGCCTTTCAAGTAGTCTTTGAAAGCTTGAAATACGTTAAATGGCCTAATTAACTCCATTCGTTCAGCGATGTGTACCTCTCGTCCCGCGACCGCCTGATCTTGGACTGGCATTTTGCCAACTTGGAATTTGCTAATGCCACCCGACTAAATAACCTGTCGTTGAAGCACTGGGATCAGGACGATGACTTCGAGTTTATTGGCCACCACACAACTGTGCGGAACGGTTATTCATGTGTGCCTGTAGCTCTTACTGAAAACCTGGACATCCGTGTCAATAGCGCCGTCAAGGAGATAAAGTACGGCACCAAAGGTGTGGAAGTAGTGGCTGAAAACTTGAAGACATCCAATTCGCAGATGACATACAAGGCAGACCTTGTCGTCTGCACACTTACTCTGGGCGTCCTCAAAGTGGCGGTAGCACATAAGGAGTCACAGCAGAGTAACACAGTCAAGTTCGACCCGCCATTGCCGGACTGGAAACAGCAGGCCATCAAAAGGCTGGGATTTGGGAATCTCAATAAGGTTGTGCTCTGCTTCGATCGCATTTTTTGGGATCCCAACGCTAATCTCTTCGGACACGTGGGCAGCACGACGGCGAGTAGAGGTAAGTGATGTGACTTTTGGCATTTGCTTATCCTATTCATCCATTACCAGACCTG CCTGGAAAGACTTTCAACAGCCCAAATTGTATTGGTAATTAAATGTGTTCAACGTATTAATTGCAGGAGAAATGTTTCTGTTCTGGAGTATAAGCTCATCTCCGGTGTTGCTCGCTCTAGTCGCCGGAATGGCAGCGAATCTGGTGGAGAGCGTGACGGATGACATCATAATCGGGCGTTGTATGTCGGTGCTAAAAAACATCTTCGGGAATACCTCTGTTCCACAACCCAAGGAAACAGTGGTAACGCGTTGGCGCAGCGATCCCTGGGCCCGTGGGTCGTACAGCTACGTATCCGTTGGTTCCTCGGGCAGTGACTACGATCTGCTGGCGGCGCCGGTCATTCCGCCGTCCAGTAAGGATGCGGAAGGATTGCCACGGCTATTCTTCGCGGGTGAGCATACGATACGGAATTATCCGGCCACTGTGCATGGAGCGTACTTGAGCGGATTGCGCGAGGCGGGACGTATTGCGGATTACTATCTCGGCTATCCAGAGGGAACACCGCCGGACATTGGCTACTCGGTGGCTGAGGCGGCCAATCTGGTGTCCGTGGGAAATGTTGTCAAGCTGCGCGACCTCTCGCCCAATCTATCTGACTCCTCCCCGTCGTCAAAGAAGTCGGAGGAGAATTCAAACTCAAACACTGCCGACTCTACGGAGCTACAGTAACAATGTATTTAGCGTGATGGATTTGGTCCCCAGCAGTTACTCCTAGAGCGTTTAGTTTTGTATCATACAACTGGGGCTCGCTGTTTAAAACGAAGCTAGGCCGCTGTAAATACCTAAGACTATTCAACTAAGCATAGACCACTTTCATTCAACCAATTATAAATTAAGATAAAAAGCAATAACACCCAACAAAGCAAATCCTCTTCAGTGTTTCCTTCAGATCAAAGTAAACCAACCTCTGTGCGCCTATAATTGATCAACAAATGCAATCATCTATCATAACTTTCCGTACCACTTACCCGCCAATGAG


Search Again