CR00477

CRIMIC CR00477

Gene Kul

CG1964

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78922

Images

Construct Sequences

sgRNA sequence
TCAGAAGATGAAGTCAGCACAGG

Amplicon 5' Amplicon 3'
GATGATTTTCGCGTCCTGGCCTCCGAAGAGGACAAGAGCGAGGAGTCGCCGCGGAAGTACCCGACCACGTCCACAACCAGGAGCACTGTGCGCAGCACCGAGAGCTTCCTGGCCACTCTGACTAAGCCCACGTCGAACCGCAACATACTTGTAAATAACTACAATCCCTCCAATCTCGGCGAGGGAAGTCGCAGCTACAGCAGCGGCAACAACAACGCCAACAGCAATAGTAACAACAATAACAGCAACAACAACAATAATAATAATAATAGTAATAACAATGTGCGGAAGTTGTACACGAAACACAAGAACATTATTGTAAGCACGTACAACCGACCCATCGAACCGGAATTCGGAACGCCCTACGAGGAGCCGAATAACAATGGCACCCGCGAGCTGCCCAGTAACTTCTTCAATGCCAACTGGACGACGCTCTTTCTGGGAAACAACAACAATGGCAACGACCGGCCCAGCCACAAGACGCATGTGGAGATCATCACGAAGAACGGAGCCACCAAGAAGCCAAACATCATTGTGAACAACTACAATCCGGAGATCATATTCGCACCCAATCCGCACAATCCGAGTTTTAACAGCATGATGATGACAAACCTGCTGAGTGGAAGGGGTGGCGAGGACATTCACAGCTCTCCCAGGCTGCTCTACGACCGCAAGACCACTTGCATGCTATACCTGCAGGCGGACCACACGTTCTTCCAGAAGATGGGCTCGGACGAGGCGTCCATAGAGGCCATCACTCGGCACGTACAGCGTGCGAACACAATCTACCGGAACACGGACTTCAACAACGATGGGAAGCCGGACAACATCACCTTCATGATCAAGCGCATCAAGGTGCACAACATGAACGCGATGAAGGATCCCAGCTACCGATTCCCCGGTAACTACGGCGTGGAAAAGTTTCTGGAGCTGTTTTCGGGTGAGTGAACTTAACTTTCTGGATAATTGATCCGGTTTTGAGATCCTG TGAGATCCTGTGCTGACTTCATCTTCTGATTAATTGATATGCAATTAACATTATCTGTGATTTCTTGATACATGTTTAATTAATTATATTTGTGTTGCGTGTATAATTTATATGAACTTTTGTTGATTTATTTTACAGAGGAGGACTACGATGCCTTTTGTTTGGCTTACATGTTCACCTACCGTGATTTCGAGATGGGAACCTTGGGATTGGCCTGGACGGGAGATCTCAAGAACGCTGGCGGAGTCTGCGAAAAGAATGGTCACTACCGGGGGTCCCTTAAGTCACTCAATACAGGAATAGTCACTCTGTTGAACTATGGAAAGCATGTGCCACCGGCTGTCTCCCACGTGACTTTGGCCCACGAAATTGGACACAACTTTGGATCACCAGTGAGAATTCTATAATTGTTTATAAAATATTACACGTTGTTAAGAGTACTTTCCAATTTCAGCACGATCCGGAGCAGTGTACGCCTGGTGGCGAGGATGGTAACTTCATTATGTTTGCCCGCGCCACTTCGGGCGACAAGAAGAACAACAATAAGTTCAGCACCTGCTCGCTGAAATCAATAGAGCCCGTGCTGAATGCCAAGGCGCGTTCCATGAAGGGCTGCTTCACCGAGCCGCAGTCATCGATTTGCGGCAATGGCGTGGTGGAGCCGGGCGAGCAGTGCGACTGCGGCTGGGAGGAGGACTGCAAGGACTCGTGCTGCTTTCCCATGTCAAGGCAACCGCGTCTGGATGAAACTCCGTGCACGCTGACGCCGCATGCCCGCTGCAGTCCTTCGCAAGGTCCCTGCTGCACCACCGATTGCAAGCTGAAGTTCGGTGACAAGTGTCGGGATGATAACGGCTGTCGGGATCCTTCATTCTGTGATGGGCGAGTGCCCCAGTGTCCGCCGTCGGTGAACAAGCCCAACAAAACCATCTGCAACAAGGAATTCGTCTGCTACATGGGCGACTGTACGGGTAGCATCTGCTTGGCCTATGGTCTGGAATCGTGCCAGTGCATTCCCGGACCGCAGGACGATCGGATCAAGTCATGCGAGCTGTGT


Search Again