CR00474

CRIMIC CR00474

Gene CG32174

CG32174

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK short band79267

Images

Construct Sequences

sgRNA sequence
TTCACTGTCCAAATTCTCTTAGG

Amplicon 5' Amplicon 3'
GGAGTTGCCACATCGGGTTAAGTTTTGATGCGATCATTCGCGGAAATTGACTGTTCTCACTGTGCTCAAATTCTAATATAAAAAATAATATAAAGTTTTTTTCTCGATCTTTAAATTATTTCGGCAAACTGCATCAACTTTTATATTTATTGCTATAATCAAATAATAATTTTCTTTGTAAGTGGAAACATCTACAATCAGTTCGACGTTACACGACGTTGCCAGATCACAATTCTACGATCGCGATAGGACTGCTCGATACTAATAGTCGATAAGTTCAAAATTTAAAAATGGGCTTAAAAATAAACAGCCTTATCAAGCTTTATTCAGCACAGTAATGCCCAATTCGGAGCGCAGCTCGTGGATGTTCTGCTCCCAGCGCTTCTCCCAGTAGACGGGCATCAAGGGCTTGGTCCGCTTGCCGTTCTCCAGGGCCCACGGCAAGTAATGCTTCAAGTACGCACGCCGCTGCCTAAGTGGAGGAGAAAATAAACAAACGCGTGAATGGGGAGCTATAATTAGAGAACCCAGTTCACTGAACTCACTTGGGACGTAGGCGAACTGCTCCGAATACCGCACCACCGTAGCACATGGGCAGGCCCGTGTTCAGAGCCTCCACCCACTTGACAGCCACCTCGCCCAGCATATTGGTGGGCATGTCCAGCACCGTGTGGATTAGGTCGTGGCATTCGCGATATCGCGTCATCAAGTAGGCCAACTTCGGGTCCTCCAAAAACCGCACGGCCATGCGACTGTCCGGCGTGACTTGCTGAAAATTGATTACCAAAATAATCGTTGAAGCGATGGACAAAAGCAATTATTATTTTATTTTCCATCTAAATATATCTTTTATATGCAAGTATGTTTATGAGACAATAATTTTTAAGATTTTCAATTGTTACCAACTTCAAATTCGACCATGACATTCACTGT TGTCTTTGAACCAGATTTTCGTCGTTTTATGGTTACTAACGCTTTTTCTTACCGGATTCTTTGAACTACTTACATTATCTTTCAGAAACTTTACGTAAGCGGCTCCAAAGGTATCCGGTGGCAAAGTTTCCAGATACTTGAAGTCAATGGTGCTGGTGTGGATGCGGGGCTTATCAGCCATGATGCGCTGACCCTCCTCGCTGGCTTGCATGGTGTCCAAAATTGTCCATAGAGCATCCTCTCCAGTCGTCTCACCCAAACAGGCGATCATGTCATGACTTCATAATAATAATTAAGAGTTTTAAGAGATTTTTAAATTTCATCAGATGCCCTACCGTCTTGGATTCAAGAGCGCGGCAATGGAGGATCCTGCCCCCAGGAACAGCCGCTGGAAGGGCGATATCTCGATTCGCTCCTTGAGGTACTGACGCTCGAAGGCATCCAGAGGTTCCGCCTCGGGTGCTTCTGTGGCCACCGCTTGGCTATTAGCCTGGGCCAAGCGAAGGCCTCGTCGTAGGGCCAGCGGCTTTTGGAGACGCAAACAGCGTTGCATCATGATGATCTGTGGATTCATAGAGGAGATATGGGGAGGTGCACCCGGTGGTGACCTTATCAGCACGATCGTCGGCATCATCATCATTACATTATTATTATCATCATCATCATCGTCGCACACAAACATGACCCTGACTACCTGTCTTCGGTTAAAGCTGGTCCCTCGAGCCATACGTACGTATGTACGTGCCCACTTTCAATAGCGGCGAATATGAGCAAACAATTTGTCCATAATGTGGGTACGCGGTCGGGGCTGATGCTGACTAACAATTTACCTCACCGCACGGCTAAGTCTGTGCAAACCTGTTTCGGCTTCCTCATTACCTGTCCCCACTCCGAATCCCTCACTTCACCACCGCCCATCATATATTGCGGGCTCCCAAAATAACCCAAACAAAGTGCTGCCGGGGCACTAGCACCTCATTCTGCCGCTTTATGCCCGATTCAATGTCGTCA


Search Again