CR00473

CRIMIC CR00473

Gene CG2926

CG2926

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79266

Images

Construct Sequences

sgRNA sequence
TAGTAGGAGTATTTAGTATACGG

Amplicon 5' Amplicon 3'
GTCGCTTAGACGGAGCTCTCTTGGGGCTGACCTGTGCCTCCGTTTCCGTAAGCAGTGCCTTCTCGAACTCTTTCGGTTTGTCAATGTCTAACTCCTCCCAGTCGCTATCATCATAAAGCTCGAGTACTCCCTTGGCCCGATCTCGATCCGCAGCGCGATCCTCTTTGACCAGTGGGCTGGGAGTGCTGCGCGTCCTAGCTTCCTCAGCATCGTTTTCCTCTGGGGCTGCAGCTTGCACGTTGGAGTTGCTTGGCTCGTGATCTGAGGACTCGGACTTCTCCGTTGGAACAGCGTCACAGGACTCTTCGAACATTTCGGGTTCTTCAGGTTCTTCGGTTGGATTCTCTGGCTCGTAGAGGTCATCATCACTACTTTTCGGGACTTTTTCGGGAACGGGTTCGGGCTCAGGCCCCAAAGGCAATGGTATATCCGTATCCTCATCATCATCATCTAATTGTACTAAATCTTCATTCATATCGTCATCATCCTGTCCCAGAGGAAAGGATTAAATGAAGATGAAAAGAGAAGATTAGAGATTAGTAAGCGTTGAAGAAGAATTGGTCTGAAAAACTATCAAACGTGACTTACTTAACTAATTATATTGCTTGCTTTGGTTTCAATAACATTATATTTGGTTTTAAAAACTGAAAATTAAAATGTTATACATTTGTGTATCTTTTTGTTTCGGAAGATTATGGCGAGAATAATGATGTACCCATTACTTACCTATATAATTTTAAATATGCTTTTTTGTTTGCATAATTTTGCCTTTTATTACTGGTAATAAAGTTAATAACTACCCACTTCAAACATTTTTCATCACCAAAGCTGATATCAAAATCACTTTTTTCTTTACCTCGCTTAATTTGTTTGATAATTACCTAAATCAACATTAAAATCTTCGGTTCCGT GGTTCCGTATACTAAATACTCCTACTATTATTCATGTTAAATATCTCTAGATTCTGAAAACCCCATAGATATCATACCTTATCAGATGCATCCGCTGGTCCGTGTGGAACCCCTGACGGCATCGCCGAGGCATTAGCAACCGCCTGCGACTCCTGCGAGTAAATTGAGAAGTTTGGGCAGTTGTCAACATCGTCGTTTTGGTTGCCATCGTTGGATTTGGCCGGTGCTTGCTGGAGTGGGGTTATCTTGAAGAGAGGACTGTTCCATGGAAGGCTGGCAGGTGGCATAGGCGGAGGTGGTATGGACAGCACAACTGGCATACCCATCACTGGTGCAGGATGATGATTGAGGGGAGCTGCAAACATTGGAGTCTGTCCCGAAAAATTGTTTGATGACGACGCTACTGGGGCTGGAGGCGGTGCACTTCCAGGGAAAGGCGGGGTGGGTTGGTTAGCTGGCAGCACGTTTTGCTGTCGTGGTTGCTGCTGGCGGGTGGGCGTGTTGAATCGCAGATGGAACGGAATAAAGCTTGACATATTAGTGTTGTTGTTGGAGCCGGAGCTGCTAAAGTTTTGGTTGCCAAAGCCACCGCCTCCTTGGCCGTCTCCTTCACCGGTCAAGTGTCGCGAGGAAGCTTCCCCGCTACTGCTGGGCACACCACTACCACCGCTAGATCCTCCAGCGCCGCCTCCACCACCTCCGCGGTAACTGGTATTGCCGCTGTAACGATTGTTGTAACTATCACTTGAGCCTGCTCCTCCGCCTCTGTTGTAGTTAGGTCCTCCTCCTCCCTGTTGGTAAAGCGGTGCCTGGGTTAAATGCTTCTCGGTCTTAGAAGTACCTGCTTTCGGTAAAGGCGCTTCCGTCGCTGTAGGTGCAGGTCTCTGGGGAATATTGAGGGTACCGTCCGCCCTAATATGCACT


Search Again