CR00471

CRIMIC CR00471

Gene Atac3

CG32343

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78921

Images

Construct Sequences

sgRNA sequence
AGCAAGAACATTCCCAACTTTGG

Amplicon 5' Amplicon 3'
GACTGCTTCGTCGCATTGACGATTGTCTTGCCAGGTGCCGCCCCGTTGTTTACTGCGCCTTGGCCGGATCCTGCCGAGAGTGAAGGTCGCAGCTGTATCGTCTGGACGGTGCCCACTTGTCCCCTAAGCGAACTGCCCGACGCGGGATGGCCTGAAGGCAGTGGGGATGGGACCGCGGCTTCGTTCTGGCTGTGTGATTCTTCTAGCGCAGTGAGATCCTGCGGCCTTTGCAGGGAGGGGAGCTTTAACTAATTAAGCGGGGTTCAAGTAAAGTAAGGAGGTGAGCTCAGAAACTATTTAATATTCACCTGTCGAGCCTGCAACTGGCGCATGTTGACTAGCTTTGTGCCATCGGGAAGATGCCGCACCATTCCAGAGCTGTCGATAAGGCAAGATCTTATATATATCTCCCAAATATGTGAAATTAACGTACCTTGCCAATGAGGCGGGTATTTTCTGAAGGGACTTTGCCGTGCTGTCCGATCCGTAGAGTTTCTTAAAATCAGTCAACGAGATAATGCGTATATTCTGCCCTCAAATATTAATTATTATACGAATTAGCGAAACAAAACAATGAAATGCATACCTTGTTCTTGGCAACTCCCGCCGGTGACGGAAGATCCTTCTGCTTCAGGACATTCATCCGAATCTTGGGATGAGAATTATTAACATTTGTGCGGAGCGCTGCGACCGAAGGCCGGGCGTTTCCGTTCGTGGATTGCTTGCCGCTGATGCCCGATTTTGTTTCGTGCAGCAGCATGCGTCCTCCTTCAGAGAGGACAAGTTGGCGTCCATTCTGCAACGCAGTGTTCAGCATTTCTTTCGAGTCCTCGTCATCGTTGTCCTGCACCATGTCTGCGATTTCGTGCGTCTTTAGTATGTAAAGCGCAGTGTTCCGCAGGACGTTTGCATCTGGCAGGGAAAATAGGTTTTTCGTTAAATATTCGTTTAATATCTCCGAATCTAGTAACTTACGGCCTCGCATGTTTTCTAGGACATCCATTCGTTCTTCAACCGACATTTCTTTGTCGTCCACGGTTTTAATTACTTCCGGTTCGTCCATTATTGAGCTGACAGCTTCATTGGTTTCCTTCTGCAAATCGATGGGGAATAAATATGATATGATTTTTCTTTCTGCGAATCAATTGGGAATAAAGTATTTGTCACAATTTTTTAGGATCAGGAATGTAGGCCA CCAAAGTTGGGAATGTTCTTGCTATTATTTGTGACAACCTAATACAAGTTGTCGAAAGTACATACTTTGGTCTTATGTGCTTGTTGCTGAAGTTTGATAAGCGCAGCGTGGGAAAAGGCAGCGATCAATTGTATTGTTAAGAATAAGGAACAGCCAAGCGAAACGTAAGTAAAACCTCATATTAAGTAGTAAATATGGCCTTCAGTGGATTTCTTCAAGCGCACTCACCTCCGATTCCTCGTGTAACTTCTTACTGGCCTGCGCCTGTCGTGCCGCTTCCAACTCCGCCAGCACATCCGCTTGTTCCGTGTACACGGCAAGTCCGATCGGCGTCTTGCCGAATTTGGAGACCAAGGTGACATCTGCCTGGCACTTGAGTAGCAGGCGCACAATTCCCTTGTGTTTTTTCTCGACCGCCCAGTGCAGCGGGGTCATGCGAAGCTGACAGGAATGTTGGTTAGTCATTTTAAACAGTCATTTATTTATATATTCTTACCATGTCGCGGGAGTTGACGCTGCACTTTAGCGCTAGCAGCAAGCTGACTATCCGCTCGTGACC


Search Again