CR00470

CRIMIC CR00470

Gene Mul1

CG1134

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78920

Images

Construct Sequences

sgRNA sequence
ATATTTAGGGTTTATGGTCATGG

Amplicon 5' Amplicon 3'
TGGTGTGGAGATTGTGGACGCCTTGAGTGCCGCCGTCTTGGACGTGGACGTGGTCTACGACAACTACGAGCCCTCCAATCTGTCCCTCTTCGACCATGTGTTTGGTTTCTTCTCTGGCGTCCGTCAGAGGGGATTGCAAACGACGGAGGAGGTGCTCAGAGAAGGCAGCTTCCTGACCGCTATTGGTGAACTGGAGTTGGATGGCGATACTCTGCGCATGCAGCCCTCCAATGAGGGACCGCTCTTCCTGACCACTGCCACCAAGTCCACGCTTATTAAGCGGTTCGAAGATGCCAAGACAACGACGATGTGGGTGGTGCTTACTCTGGGTGTATACTCTTAATACTTTCTACTTAATCCCTTCTAGACTCAAGCTGGTTGTGTGCAGCACCATCTCTGCCATCCTGGTTGCCTTCATTGCCAAGAAACTCTACCGAAAACGAAAGCAGGAGCGGGAGGAGGCCAAAATTCGCGAACGCCTGGATACGGAGCGTCGGGAGCGGAGGGCGAGGAGTCGTCCTCACACTCTGTCCCAGGATCAACTCTGCGTGGTGTGCTCCACCAATCCCAAGGAGGTGAATATAACCCTTGCATTCCTATTGCGAATTTACATAATTCTATCCTCTGAGAATCCGTATCTTGAAATTTAATTATTCTACTTGTATTGATATTTAATGAGTTTACCAAAATTAAGATAAGGGAAATATAATTTTTAATGCTTAGATAATAAGACCCATTGCAGTAAAGTTT ACAATACCATGACCATAAACCCTAAATATAAGTGATGTAATGTTTATATGATTACTGCCATTATTAAACACGTCCCTTTTTTTCTTCTAGATTATCCTACTGCCATGTGGTCATGTGTGTCTCTGCGAGGACTGTGCCCAGAAAATCTCCGTCACCTGCCCCGTGTGTCGTGGTAGCATCGTCTCCAAGGCAGCCGCCTTCATCGCCTAGGAACCAACGAAGATGCCAACAAGATCACCTTGTACCTGTGTGCGCCAAACTTTTTATTTGTTACAATGCTCATGTACGGCATTTATTTAAAATTATTGAAAGTCTTGACATCGGAATGAAAAAAAATCACTTTGTGTCTGCCTGCATAATGCGCCTGTACTGTCGTTGGTTCTCCAGCAGCTGCAGGAACACCTTGTACTTGCGATTGTGGAACTCAAGCGTTTCCGCGTTCGGCTTCACCAGCTGGCCAGTGCCACCCATGGATTTCGAGGCGCTCTAAGAGCACAACGAGTAGTTTATAAACCAGTTAGATATTTAGATATTCTTAAGCTCACCTCCAAGCTGTCGAAGTG


Search Again