CR00468

CRIMIC CR00468

Gene mon2

CG8683

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78919

Images

Construct Sequences

sgRNA sequence
CACCACCCAACTGGGTTGTTGGG

Amplicon 5' Amplicon 3'
CGCGTTTACCAACTGCACAAGATCCTGAAATAGCAGGAATGCATCCGAAGCAAAGGTCTGCACATCCTGATTTCCGCCCTCTCCCTCAGCTGGCGAACCACTGGACTGTTGCTGCTGGAGGCTGGAAACCGAGTCTTTCTCCAGGTACACTCGCTCAAACACCAGGGACACCAGCTGCCGGATGGTGGCACCGGCCGTATTCACAATTGTGGGATTTTTGGCGTAGTGCAGGCGAAAGCACAGAACTAAGGCCTTGGCCAATGTGTCGCCGTGCACCACCGTATTGGTGGTCAGCAAAAGAGTTACTGTTTGCAGCACTTTGACTTCCTCGATGTTGTTCTCCATTAGGGTCCACAGTGCGTTGGTGATGTATAGGGCGCCCTTCTGGTCCACCACCTGCTGGGTGATGAGCCGCTGCATCATGCCTAAGCAAAACTGGAAAAAAGATAGGAAAGCAATTAGATATATTTACTATATAAATGGCTGCTCTTACCTTGATGATCTTGAGGTCCTTGGTCTCGCATCCCTGCACCAGCGGATAGAGTATCTGGTTGACGGTGTAGTACACCGAGTTTTGCTGGCTGCTGCCAGCTGTGCAGAGCTTGGAAATGGCCTCCTCGCACGCCTGATTGGGAATTGGAAACGTTAGAGAGTTAATTTGCAGGTGGAAATGTCATAAAAACAATTTCATATGCGCTGGCTATCAATTTCATAATTGCGTAGAGCAAGCACAGGTGGAACCAGAGCAAACCACCCCCCGCCCACCGACGTCCTTCCACCACCAC ACTCGTGTGTCGGCGGATAAGTGCCGCAATTAGACAACCACGGCCGTGAATCACACGTCAGCAGGACTCACCTCCTTGATCTGAGGATACTTCTTCTTGGTCTCCAGCGAGAGGGTCTTGAAATCCGCCTGCAGGGCCTCCACAAACTTGTGCACGTCCTGGCCACCGCACCCGCCCCCGCCCACAAACGACATGGTCACTGGTTGTACTCGCTCCTGGTCACTTGACACTCACTGCACCGGATGCGTGCGACATTTAAGTACTGCGACCGATACACGCATATGCTACGCAACCACTTTGGACTCGAGAAAATGCAATAATAATGCAGCGCACAATGAAAGCCGTGAAAAAATTGTGATTCGTTTTGACAGCTGACGTACACAGTGCAGAGTTGCTAGTGATTGGCAACGCGAGCTGGCCATGTTAACTAACATAAGCAGAACCATCATCAACAGTGGCCTGAAAAGCGCCCTTAACAGAGCAGGAGTTTCGGTGAAATTTTGTGGGTCGCCGGAAACGGAAAATAAAGATAATGGCAAGGAAGAAGTATCTTTACCAGGATGAGGCCCTAATCCCAAAAGCC


Search Again