CR00467

CRIMIC CR00467

Gene PI4KIIIalpha

CG10260

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK short band79265

Images

Construct Sequences

sgRNA sequence
AGGCACAACAGAGGTGCTGTAGG

Amplicon 5' Amplicon 3'
AGCCGATTCACTGCCTTTCAAATGCTCTCCCAGCAATTCGAGTTCAGAACTACGAGTGGCGTGAGCTAAAAGGCCAGCTAGACGCGAAACAAAATTAGAATAACTTTTGGAATGTAACATTTTTCAAATGTGTAACGTATTTTGGTCTGCATAAGGGTTAATTCGAATTTTTCGAGACACGACATTCGGTTAGGCGGCTCATTCTCGCGCACTTCGCAGCCAGCGCCACATTTGCTAGCCAATGCGCGCTGGTCACACTGGCGAAAGTAAAATAAAAAAAAATTAGTTTTATTTAATTTCTTGCGAACGAGCCACGAAAATGACGAACGCCTAGCGCGATTGCCCAAAACGACCCACTGAATCAACCGCACCGCACCGCAGCGAACCGCATCGAAACGAACGAACGGAGGAGGAGCAGGTGGCCGCCAGTTAGAGCAGCCATGACGATGACCGCCTCGGATAAATACACGTACCAGCGGACCGTTCTCTGCCTGGCCCGCGTTCTGGCGGGCATCCAGCCCACTCCCTGGGATAAGGTACATGTCCACCTGGCCACCCACTCCACCAGCCACAGCGCCAGCCCCCCTGGCAATCGACTTTTCGCACTGACCTTGAGCGGCGGCCATAAAACAGACATGCGTGGGCGCTCAGGGGGCGGCGGTAAGGCAGTGAGGCGGTGGGGCAGGAGCCCCACACCAAACCAACTCAGTTTGCAAAAGTGCCATTGGAATGTCAACAGTGCAGCGAATCTTCAGCTGTTGCTCACTGAAGCGCTCACACGAAAGCTGCTGATGATTCAGGCACAACAGAGGT AGTTGTCTTCACATCCGCTGAGGTCACCAGCAGTAGAAGCTATTAGTTAGGCGTATATCATGAGTAGAGTTGTATAGGTCAAGGAATAGGAATAGGAATAGCACTAAGCACAAGACACTGAGACACACACCCCACTAATCTATGGCTTCCTCATGCTACACGCCCACAGGTGCAGACCCTGTTCCGGTATTGTCCGCAGGAGAATGCTGCCGGAGTGTTTTGCCTGGACACGCGGGCCCAGGATGCCGTAATTGCGCTGGGCATTTATTTTCTGGAGGGCGGCTGCCAGCACGAGGGCCAGATTGTGCCCTATCTGCTGCGTCTGGCCAAGTGTCTGCCGAAGGCGGTCTGGATTGACGATGCCCGGAGCAACAAAGTGGAACGTAAGTACTAGCTGCTTGCCACTCGTGTGGCCTGTCGCACAGTTGGTTTATCCTGGCTTCCCCACTTCCATTTGGCAGGCGTTCGCATTCCGTCGGCGGAAAAGTTCAGCTTCTGCTTGAACACCCTGCTGTCCGACATAGCGGCCAAGTGTCCGGATTCGCGCGAGGAGATCATCCTGAATCAGGTGGAAACGCTGAGCGCGCTGGCCAACATAGTCAAGTCGAGCAGGGACAGCAGCTCCGCACCGCCGCCCATCATCCTGTGCAAGGCCACGGTGCCGCTGCTCTTCGGCTTGGCGCGATCGATGGGTCGCTATGCCAGCAACGATCCACCGCTGCTGTGCCGCATTTTTCCGCCCGAGCTGCTGCCCATCCAGAAGGGCGGCGGCCGCGACGGCACCGGCTCGAGCAGCAGTGCCAGCGGCACCTGCGGCGGCTCCTTCAGCAGCAGCGAACGCCTGGCGGCCACGCATCACTTCCGACCCATCATACCGCGCTCCATGTCCGGCAGTCTGGCGCAGGCCCAGAACGCAAGCTACGACGATGGAAGGCAGCGGTGCGCGGGCGGCAAGCCCAGCAAGCCATCGTTGCACAGCTACTTTTCGGTGCCGTACGATCCGCGGACGCACTTCTTCACGCGCTACGGCTCCAGTTTCAACCAATTCCCGAACATGCGCGTCTGCGAATCGCCCACGAAAGGCGGCCCACGACCACTGTATCGTGTGCCTCCGTTTCCCATCCAGCATCTACAGACCATATTCGCGGTGTCC


Search Again