CR00466

CRIMIC CR00466

Gene Eps-15

CG16932

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78918

Images

Construct Sequences

sgRNA sequence
AGCAAGGAAAAGGCAAGCAGTGG

Amplicon 5' Amplicon 3'
GGGCAGTTGCACTTCCTTTGTCAGGGTCTTGCGCGCCTCATCAAAGTCCGGCTCTATCTTCAACTGGTATTCGGATACGAGTTCCGCGTTTTGGTTCTCCATGGCAGCCCGACAAATGAGCAAAGCGTCGGTCATCTGTCGCTGCGTCTCCAGCAGCTGTGTGACCATTGATCGGACCTTCAGACGACTTATGTTAATCTCTGATCACTTGATTGTATCATGTGTAGTCTTACCGAGCTGATTTGCAGTTGGGTTGCCTGCAGGTGGTTGGTTAGCTTGGATAACTCCCGATTGTTGCTGTCGTACTCCTTTTGCAACGAAGCTTCTTCGTCCTTGAGCTTCTGCAGCTCCGAGCGTTTTGCGTTTAATTCGCCCTCCTGCTCGTTGATGGTCACCTCCTGCATGTGGCACTGGTCGCGAATCTTGGTCACCTGCAAGCAAGCGGGTTTCTCGATCAATAATTAGGCTATTTTATAAAAATATTTCGGACAACAGATGGTCAAAAACATAAATTACATGGCCGAGAACAAAACACAAAAGAAATATATACAGAAATCATGAGAAACTGAAACAAACCTGCTCGTTGGTGCGCGATATGTCAAGACTTACGTTGGCCAGCACGGCCGTATTGTGGCTAACCTTATGCGATCGTAATTGTAAGTGTAAGTGCATTCACCGGTTTAGTATGGATTTAGCCAATAGTTAACAAAGTGGTGGGGGAACATGATAAAGAAAGGAAACCAAAGATTGAATTTAAATATAAAATTAAACGTAAGCCCAGGAGCAA GGGCCAAAAGCACCCAAAGAATCATGCAAATAACTACTTGAGCCTGCAGGTCATCCAGTCGCTTCTGGGCCTCTCCTCGCTGGTTCTCCAGCTGCTTCAGTGTGGCGGTAAGAGTATCCAGTTCACTCTGTGGGTGAAGATTCTGAATTATTAAATTCGACTTGGAAACTAGTTACAGAAGACTCGCCTGCAAACTGCGCACTTCGCCGTTTTTGATGCGCACATCCGCTTCCTTTTGGGCAATCTCCGTCTCCAGAACCCGCCGCTCACGGGCCAACTCCTCAATCTCCTTGGAGATCATTTCCAGCTCCGGGTTTGAGTAAGTGGGCTTGACCTCCTGCGGCTGCAGATCGACTCCAGCCACAGTGGCGCGCATTGAGGGCGGCACCATATTGGCGTTGAGGACATGTGGCGGGTCCACACCGCGCTGCTTTCGCTCCACGAACCACATGGCCAGTGCAAACTGCTCCACAGTCAGCTTACCGGACTGATTGGTGTCACA


Search Again