CR00465

CRIMIC CR00465

Gene Dap160

CG1099

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78917

Images

Construct Sequences

sgRNA sequence
AAAAGCATTGGATTAGTAGATGG

Amplicon 5' Amplicon 3'
AGACCGGAAAGGCCATTCAGCTCGCCACGCCACCACTCCGGCTCATCCCGACCCAGAACGCTAATGATATCGTCCTTATCAAACGACAGCTCGTCGTCATTTTGTGCTTTGTACGGATAGAGAGCAATGACCTTGTCTGCATGGGAAAAACGATATAGATAAAATAATTTATTTAAATCATACTACGAATATTCAAAAACCAACCCAAGATCTGTTCAGTCATCTCGATTCGACTACCGGAAACCGGAGTATTCCGTCCGCTGTTGCGCCCGCCTTGGAGAACCTTCACGTAAGTGGCCGGGAACCATCCGATCTGCCGCCGTCGACCCTTTGCCTGCAGCTCACCCTCCCACCAGCCGGAGTCCGTCTTTTTACGGATCATTATTAATTGGCCTCTCGTCAGCGAAAGCTGTTCCGTGCTGGTTGCCTCATAGGGCGCGATTACTTGAGCAATCTCAGACCGCTTGGCACGCATTCCCTGCAAAATGATGACGAAAAAGATGTTGGTTCATTAAATGAAACAATAAATGAAGTGGTAACGGGCTGTGTCAACTATTTACGGGTGTCATGGAAGAGGTGCGTGACATGGGTCGGCTGTAGCTCTCGGCAGGCTCGCTGCTCTGTGTTTTGGACTGTGTATTTATCTGGGAAACTTCAGTGTCGAGGTCTTCGTGCGCCTCCTCGGCGCCAACGCCTGGGCTAGATATCGGCTGCTCGCTGGGCTCCTGAACAGGCAGCGGCTGGTAAACCTGCTCCTGTGCCTCCACGGGAGCAGCGGTGTAGGCAGCGTTGCCGTTTAGCGTCGTCTCCTGGGTCAGTGCAAGTGTAACACGGTAGCAAAAAGCACAGCACA GTGAGGGCAACGGTTAGACACGACTCTAGACTTCGGGATTGTAAACTCTTTACAAGTAAGATAAAGTGTTGGCCTGTATATTTAGCGTTTATATTCTCTTATATGGGAACTAAATTCACTTCTCTCTTATATAAATAATGTCGCTTACTTTTTTTTAATATGAAATTGTACACGATTTTGTATACATAATAATATTATAATTCTTGATTCTAGTTCCAATCAATTTAAAACGCAAATGGCCCCACACATTACTTAATTATGTACTATCTATCCACTTACCTGATCAAGAGATTCTACCGGTTCGGCAGCGGCTGTGCTCGCTGTGCCCACATCAGCCTTTTGGACATAGTTCGAAGGAAACATGCCCGTGCGGCTACCAATGGTACCTGTCCACCACTCACCCTCCTTCTTGATGACCATGACCATCTCACCGGCACTGAAGCTCAAATCGCCTTCCTCGGCGGACTCATAAGGATATGCGGCTATATAATACTCGACATCGCCGGCGGCAGTCAGATCTGCGGAAGCTGCCGGAATCGAGCTGGTATTGATATTGTCATTGTAGGTGTCAGCCACGGTGGCCACTTGAGCATCAACCGGGGCTTCGACAGCGGCGACAGGAGCAACTTCACCGA


Search Again