CR00464

CRIMIC CR00464

Gene CG2543

CG2543

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CCAATCAGAGAATTGTGGCGAGG

Amplicon 5' Amplicon 3'
ATTCCGATCGGGTGTTAGCCTGGCGGAACGCGTACTTAATCCACCACAGCAGAGTATTAATGGAAATCATGTCTCGGGCAATATCCAATGCAGCAGCGATAACAATAACAAGGATACAAATGCAGCCTTTGAGGTAAATCTAAAACAATTCCCAAGTCCCAAGTTGGAAACCAACAGATACAATTTTTAATTACTTTGTCATAGTTTTATTACCTATTACTTATTAATATCATACCTTTGATTTCACAATCGTAGCATTATCTTTTCGATTTCAAAAATGAGATTATTCTAAATCTAAATAATAAAAACCATTCATGTGTTTTCAGAATTATGTGTGTGATTAATATGAAATTTGGTATTACAGTAGCAAATGTTTCATCTTCAGTGTGAAATGTTTCTATATGTCATGCTGACCCAGCTAAATACCAAATTCGTTTGTTATTAATTAATTAATTTCCTACCGTTTTCAGTTGGCCATTAAGCAGTTAAATTCCCTGCAATCGAACGATGCTGCCATAAGGAATTCAATGAGTAATTCCCGTGTGGATACCAAAGCGGATACCATTAAATATCTGGAGCGGAGTGGTCTGCCGCTGGAAACTGTAGAGCAACTGTCCTTCATCCATGTGGCCGGCACCAAGGGCAAGGTATATCAATGGCTTCAACCTGTTTTCTTATGGTTCTCTTGGCTTTGCTCTCTCGTGCGTTGAGCTCTTGT AGGTTGCTAATCGCTCAGTTGCTGATTAGATTTGTTTAGGTTCCAATTTGATATTTGTTTTGATCAATCTGTTTGGGTTTTTGATACCCTTTATGCGTCTATCAGACGGGTATATGTACATATACATATGTATATCAATATAATTGCAGTTAATATTTAATTTACATTCATTTCGAGAACTTTAAATAATATCATTATCTTCTTTTGGTTTGGGTAATTAATTCCTTTCTATATAATGAATCTAAATTCGTACTCCCTGGCTAGTTTGTATGTAAGAGGAGTATCATATTGTCCATTGTAATCTCTCAAATGTTTTTTGTTTCAAATTTCAGTTTCTCCATAATTTCAGCCTTGACTTCTCTGCTTTTTATTTGCACGTTTTTGTACTGGTTAATGGGACACGTCCATAGATAACTAACATAATCAGATAAAATCGTTGTTAAAGTGGATTAGAATTCTGATAATTTAGCACTTGACTATTTGAATGAAAAAGTTGCTGGGCTTCCAACATACCTTTTAATTCAGAAAAATACCATAGAAATAATGAAATTCACATAAATTGCCAATACGACTTCCCTTTAAGTTTTTAAGTTTTAAGTTTTATTGTTATTAATGATGATGAATACGTCTTCATATAGGGCTCCACCTGCGCCTTGACGGAATCTCTGCTTCGCCATCAAGGTTTCCGCACGGGATTCTTCAGTTCTCCCCACATCCTCTTCACGAACGAGCGGATACGTA


Search Again