CR00463

CRIMIC CR00463

Gene CG8032

CG8032

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK no band80585

Images

Construct Sequences

sgRNA sequence
TGGAAAAATCTATAATCAACTGG

Amplicon 5' Amplicon 3'
GCTCGCTTTGAAATCGCGATTACGTTATTGCATTGCACATCGCATGCATTTATTTACAAAAATTATGTTTTTATCAGCGCGACGAGTAATTCGTGTACATAGGTCGTTGGAACTGTCTGGCAGCTCTGTTAGTGCTGGCAGGTGGTCGATAACAAGTGGAGTGTGATTAGAGCGATTACTTTTTATTTCAAATACTTTGTAATAAACTTGTTAGTGTCTTAATTAAAACAATTCAAATCTTCAATTTGAAATGTATATTAAAATCAAAAGTTTCATGAAATCACAGACGTTAAAGTATCGATACATTTAGTGCTGTAAAATGACAGCTGGCTTGTTTACCCTTATAAGCTTCAAGTCTGGCAATACTGCGACCAGCAGCTGTCGTAAAACTTATCCTTCAAACTTTCAATTAAAATACGTTTTTCTGAAAAAATCGCTTATCAAACTCCCATACATAAAAATAAAACTATTATTACACAATGTTTACTAAAAAAAATTGGATATTTACCACCCAGCCGAACAGCTGTTCGCTGCTACCTCCCCCAACCCATAAACCTACTGTCAAGTAAACGTCAAAACAGTCGCGCGACTCGCCAAGCGAAAAAACCTGCAGAAAAATTGAAATGCGGCGTGAAAGATACTAGAAAAATAACAAATAAACACCGGGTATCCGCAATTAAAACGCTTATGTACATAGAAGCCAAAGTGTAGCAATGGGCGACAAGGAGGAGCCCGTAACACCCGCTCCCTCGCCCACGGAGGAGGGTATGGCCAATATTGGGTCTGCTGGAGCCGGGGATCAGCCGCAAACTTCAGGGAATAATACCAACGTTAAGATCGTGATCATTGGAGCTGGAATGGCTGGCCTATCGGCTGCAAATCACCTTTTGCAAAACGGCTGTGACGATTTCCTTATTCTGGAGGCACGGGGCCGGGTGGGCGGACGCATTGTGTCCATACCGCTCAGCAATAATCAGAAGGTACCATTTGTTATATAACCCCCTCAAGTCCAAAAACCAAAACAAACCATCATAGGCGACCATATGGTATTAAAGGAAAAACACTTCCGACTCGGAAAAACCACGAGCATGTTGTAACACATTCTTCGCCCCAGCC GATTTTTCCACGGACTGCGCAGTCGGTCAGCTGTTCACGCTTTTCATTAAAGCTATTTTTATACATGTTCCTGTTCCCTCTATTTGCCTATTGTTAGCTTTATTTGTTACATATGCTTACATGGGGGTAATTAATGTAATTGCATCTGTCGTGAATCTTACTCACGATTTTCATTCCGTTCATTAGCATAGTTTTGATCGGTTTGGCGGCACCTTATCAAGAAATTTGTTATACAACTTTCTTCGGCAACGTTTGTCAGATTAGATAGGGGTTTTCTGAATTAAGCCAATGATGACGTATCTAGTGCAATGCCCTGAAAAACTCACGGGTTTGCGGGCTAACGATCACGTAGTCTTAGTTATGGGACTGAAAAATTTATTATTTTTCCAGTTTTCCACATTGTTTCACTTCACATGTACTAATTACGCCCCTAAATTATCTAATATAGGTCAGTTCTTATCTTTTTTATACTAGAAAGTTAAATGTTAAGCTTTGCCTACTTATCTGAGATGTTCCTATTTAAACACTTCTATTTCACAGATAGAACTTGGCGCCAACTGGATACACGGCGTTCTGGGCAATCCCATCTTTGAGCTGGCCGTACAACAT


Search Again