CR00462

CRIMIC CR00462

Gene fliI

CG1484

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band OK79264

Images

Construct Sequences

sgRNA sequence
CGCACTTATGACTAATGCTCAGG

Amplicon 5' Amplicon 3'
TCACATTCCGAAGACTGGGCAAAGTATGAAAATTTCGTGTCGTTCAATTTGGTCACACCCTCTGGATTATGCTCACGATACGATGTTACTGTTTTTTCGCAGGACGAAAAGGACCCTTCGAAAAACCCGAACCCCATCCAATGTGACCGTTTTGAGCAAACTAACATAGTCCGAAGCGTTCGGCTCTCACAGATCAGCAAAAAGGAATTTATTATATTTAAGTCTTAAGGCACACATCAAATGTATAGTTAATCAAATTTAGTTTATACAAATTATATGTGTATTTCAATTTCTTTAAATAAATAATAAATAAATCAAAAACAAAAACCTTGGTTTCAATCACTTACTCCGTTAGTTTTCAACGTATTATTTGTAAGTCCATAGGACCATTTGAAACTAACGGCTCTGTTTTCAAAAAGAATCAAAAACTCCAAAACTTAAGTCGCTTTTAGCTCGGTTCCGGGAATTCAAAATAATTTTTAAATTAGCCACACCATTTTTAGACATTAACGGTCACACTCGACTTAAGCTCGTATAATACAGTGGTGGACGTACCGTTAAAAGCCATGCAAAATTAATATTTAAAGGCGAGAAACTCTATTTTGGTCACAAATGTAATTATTGCCGTATATGAACCAAATTTTTTAAGCCCACAAAGCTCCCCTTCTATATGATAAATCAGCTGCACCAAACCTACGAAGTGCAACGCGAGTGTGCCTTCTGTGATTTCCAACACTTTAGTGTTGCCTAACCCTCGTAAAATGCGCAGTGTGGCCAGTTCCGGCAACTGCATACGAAGGTGCGACCATGCCGTTTGCTCGGGTGAGCGGTGAACGGTCACCACTTAGTCTTCTTTTTTTTAGTGCAAAAAAAAAACAAAATAAAGAAGAAGAAACGAAAAACAGGGCCAGCAGCTTGAGCCCAAATATAAAACAAATATAACATTTTATGTGGTCAAAATGAGCGTGCTGCCGTTTGTGCGCGGTGTGGACTTTACGAAAAATGATTTCAGCGTGAGTACAACCAGCAAAAACAGTTGCAGCCTTGTTGTTTTTTCGGAGTGGTTCAGGTTCTAAAAAAAAAAGAAGCTAAGAAACAGGTCACCGAGAAGC GAGCATTAGTCATAAGTGCGGAGCAGAGATAATCCCGAAATATGATTGATTCCATTGCAGGCAACATTCCCCAGCTCCATGCGGCAGATGTCGCGGGTGCAGTGGCTCACACTGGATCGCACGCAGCTGGCGGAGATTCCCGAGGAGCTAGGCCACCTACAGAAGCTGGAGCACCTGTCGCTGAACCACAACCGACTGGAGAAGATCTTTGGCGAGCTGACAGAGCTGTCCTGCCTGCGATCCCTCGACCTGCGGCACAATCAGCTGAAGAACAGCGGCATACCGCCGGAGCTGTTTCACCTGGAGGAGCTGACCACGCTGGACCTGTCGCACAACAAACTGAAGGAGGTGCCCGAGGGTTTGGAGCGGGCCAAGAACCTGATAGTCCTCAACCTGAGCAACAATCAGATCGAGAGCATACCCACGCCGCTGTTCATCCATCTAACGGATCTGCTGTTCCTGGATCTGTCGCACAATAGACTGGAGACACTGCCGCCGCAGACGCGACGTCTGATTAATCTGAAAACCCTGGACCTATCGCACAATCCGCTGGAGCTGTTTCAACTGCGGCAATTGCCCTCGCTGCAGAGCTTGGAGGTCCTGAAGATGAGCGGCACGCAGCGCACGCTCCTCAATTTTCCCACTAGCATAGACAGTTTGGCCAATCTCTGCGAACTGGACCTGTCGCACAATTCGCTGCCCAAGCTGCCAGACTGCGTCTACAATGTGGTCACTTTGGTGCGACTGAATCTGAGCGACAACGAGCTAACCGAACTGACTGCCGGTGTAGAGCTTTGGCAGCGTCTGGAGTCGCTGAATCTGTCGCGGAATCAATTGGTTGCGCTGCCGGCTGCCCTCTGCAAACTACCAAAGCTGCGACGATTGCTGGTGAACGACAATAAGCTAAACTTCGAGGGCATCCCCTCGGGCATCGGCAAACTCGGAGCTCTGGAGGTGTTTTCGGCAGCCAACAACCTGCTGGAAATGGTGCCAGAGGGACTCTGCCGATGCGGTGCTTTGAAGCAGCTCAACTTGAGCTGCAATCGGCTTATAACCCTGCCCGATGCCATTCACCTGCTGGAGGGCCTAGACCAGTTGGACTTGCGCAACAATCCGGAGCTAGTGATGCCGCCCAAGCCAAGCGAAGCGAGTAAAGCCACCAGTC


Search Again