CR00461

CRIMIC CR00461

Gene AhcyL1

CG9977

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band short band83175

Images

Construct Sequences

sgRNA sequence
GCTGATTCACCTGTATCGGCTGG

Amplicon 5' Amplicon 3'
TAGAGCCTGAGCACATCCCTTGCCCACATCGCCGTAGCCACAGACCACGACCTGCTTGCCACCGAACATCACGTCCGTGGAGCGCTTGAGGCTGTCCAGGATGGATTCCTTGCAGCTGTAGAGGTTGTCAAATTTGGTCTTTGTCACCGAATCGTTGACATTCATCGCCGGCACTGTCAGCTTGCCGGCCTTAGAGAGCTGATAGAGACGGTGCACTCCGGTGACGCTCTCCTCGACGATTCCCTTGACCAACTTGAACATGGTCGGGTACTTTTTTAGCATCAAGTGCGTGGCATCGCCGCCATCGTCCAGGATCATGTTTGGCTGCCAGTTCTCGGCGTTAACGCAGCGATCTATGCACCACCAGAAGTCCTCTTCCGTCTCGCCGCGCCAGGCAAAGATCGGGATTCCGGATTCGGCCAAAGCAGCAGCCACTTCGTTCTAAAAATAATAAGCAACGATATTGAGTTGTTTTAATAATGACAGTCCTTGAAGGCTAATAAAATGATTGTCAAACAGGTAAAACCCTCGAGAGTTGGCCTGATAAATCGAGTCACCCTAATGCGGCGTAAACATTTGCTAATATCTGACTTATATCGAGCTGATAACGCATCGGGCTCCATTCTCGCTAAGCACGGCACTCGTAGCTTGGCTGAT ACAGGTGAATCAGCGTGACAGGCTGTCGGGGGCCGTGGGCGATAAAAGCTGGCACGGATGGGTGCATAAATGATCGGGGAAGGGCGCTCGCCCTCGCACTCGCATCGCTTCATTAGAGAAGCCATAAATTGTTTAGCGTCAGCAGACTCGTGATAATTGCATCAGCCACGCCGCAGGAATAGGCAAACAGATCGAGTAACCGCAGCCGATCCAATGCTGGAACTAAAACTGCGTCCGTAACTTCCACTCCCAATGGTATGGCGACCCAATTCAGGGCACATCAATTACTCAGCGATTGCCAAACACTTGAGCCGCGGGCGCTTAATTGATTAACATGGCTTGATTGATCATTTGTTTGCGTCGCCTGGCGTGACAACAATTGTCTCCAAGCGACCGAGCAGATCAAGTGACCGAGCACGCATATGCATATGAATTTAAATAAATATAGGAAAATGAGTTAAGATATCTCTTAAGAGATTCCATTAAATGCATTAAGCAGCCTATGAATACGTAAGAACCCTATGACATTTTCATACGACATCTCACCTGCGTGGAGTAGATGTTGCAGGCGGCCCAGCGCACGCTGGCGCCCAGTTCCACCAGCGTCTCGATGAGCACGGCAGTCTGGGCGTTGATGTGTGTGCAACCCACGATCTTGGCATCCTTCAGAGGCTTGT


Search Again