CR00460

CRIMIC CR00460

Gene CG10492

CG10492

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79263

Images

Construct Sequences

sgRNA sequence
AATATTGCCGAGCTAAACAATGG

Amplicon 5' Amplicon 3'
AAGACAGACACAGACGCCAGTGCTCCAGCATCCTCACCCGCCGTCCCCACATGACCTGGTCATTCAGCAGCAGCCACCACACGTGATCCACCAAATACCAGGACCGCAGCAGGCGCCCCCGCACCCGCAACATCCTCAAATGGTGCAGGTACTGCAGACGCCGCAGGGCAACATACCCATGATCTTTCCCCAGCACTTTCAAAAGGTAAATCTTTAAATAGAAAACCACTAAAAGTTTATTAACTTAATCTGTTCATCTACAGCTTCTGCCCAGCTCTGATGGAACGCACCAGATCAGTGTCGATGGCATGCCGCACCTGATGCAGCCTAACATCACCATTCCAGCGGACACTAGTGCCATCATCAGTCACCAGAACACGGGATGGACGATGCGTCACTACGTGCCACAACCGCCCCACCAACAGCCCGCTCTGCAGCAACAGCAGCCGCAGAGTCTGGACCATCAAGTGCCACCTGCCAGCTCGCCGATGCTGAGTCAGCAATCCTCGCCATCGAGTAGTCGCACCACGAGTCCTCAGCGGGACCGCTCCCTTATTAACGTTCCACTGCAGGCGCAGCAGCAACCACATCAGCAGCAGCAGATGAGGGGCATGTCCCAGCGAATGGCGGATCAGAAGAACACGCGGCGTCCCTCGGCGGAGACTACCCCGCCGCCAACCTCAATTGGCGGCGAGCAGCAGCACGATGTAATTATTAAACAACTAAATAATTTGTTTATTTATTTGAAGCAAACTCAAGATTTAAATTTAAAGGAAATTAACTAATATCAGCATTAGCATCCA GCATCCATTGTTTAGCTCGGCAATATTTAGTAGTCTCCATATAATCACCATAATCATATCGCTTATACGACAAATAACTTACCTTTACAGAGTGTCAACGAAGGCGGAAGCAGTAATTCCAGCGGAACCAGTCTGCACAGACTCATCCGCAACGGTTTTCCGCGTCTAGGACACAATCATCGAGTCAAGGCAAATACCTTCATACCACAGCACCAGCAACAACAGCAGCAGCATCACTTTCAGAACCCCAACTACAACATGAACGTTATGATGCAGAGTATGAATATAAACGACGATGGCAGTGGATCGATGATGAATTCCATGAACTCCACCAAAAGTGCAGCTACCACGGGTAGTGAATCGGGCAGCTCGAATGGATCCTGTGGTGACCTGTCGCCCTCTGAGACGCCAACGCCCACGCAGCTCTCACTGCCACTGCACAATTCGGTGGATGCGGGAATGGGCATGATCACGACAGTACTGCCCACCGGTCTGGGAAACTATCAGCCGAAGCCACACCACTTCAGCTACAAGCAGCAGCAGCAGCAAATGAATCTGCAGCAGCGGCTAAACGGACGCAATGGGATGGATAAGACCTATCAGCAGGTTTACACAACGGGCACGCCAAGCATCGTCAGCGATGCACAGACCATCAGCAGCGCCAGCCTGCAGCAGCAGCAGCCCCAGACCCTTCTCATCAGCCAGTCTCCGGTGAGCACACCCACGACAACGGTGCTCCTGCAGCCGCAACAACCGCCGCCCACAACCTACAACACAAGCTATCCATATCACCAGCGAGGACC


Search Again