CR00459

CRIMIC CR00459

Gene CG14442

CG14442

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OK79262

Images

Construct Sequences

sgRNA sequence
ACTAAAGTTTGGCATCCTCCAGG

Amplicon 5' Amplicon 3'
TCGAAAAGAACCGAGTGCGAGTGATAGAGCGAAAGGGATAGATGGAGGACACACACACACACACACACGAACGCACACCTGTACAAGGGAATTAAAACCACTTTTTGTTTGTTTCTGGTTGGTAAAAGTATTTTGTTCTTAGGTTCAAGATTTACATTGCTACATATATCTACACTCTATACGATTGATTAATTCATTTGCTTCTGACCAAAAAAAAGAACTAACACAAGTAATATGAACAACGAACAATAATGTTAACTGAAATAAACTTATACGATTTTCGCTTTTGATCAAAAGAGGAGTTAAAATGCGGGTAAGGCAACGCGCAAAAAAAAAGAGAGGTCCATTGGCCGCTTCTTCTGCCAATTTCCATTGAATTCTATATATTTTCAAAATTCCTACTTTCCGGTTTCAAGCATTTTCCTTTGAGGCAGTTGATTTCGCCAACTGCAAGGAAAATATTTGAAATTTACGAGTATTGGCAATTGTTTGATATTTTACCAGCGCTACGAATTTGTATTCGATTCCAAATTCCTCTGCAACTGTAAAAATCATTTATTGTTATTATTCAGGAATCAAGCTAAATTAGGCTAATCATGTTTTGATTTTACGTTTACTGGAAGTAGATAGTGCCCTTTTTTTCTAATACCGATTAGATTTCAAATAAATAGTGTTTCTAGATAACAAATTACATTGATGGATTCATGGGCAAGATGAGGTTCCTG GGTTCCTGGAGGATGCCAAACTTTAGTTTTGCTGCGTTACTTTGTGTGTGTGTGCGTGATTTAGTTGCTATCGCCGATCATTCTTGCTATCTACTACGCCTACTGCATACGCACCTGAAGTTCCTGCTTCTTGGCAGCATATTTGTGCGGGTAGAGTTCCAGCTGGCCACCGGCGATGCTGAAGTGCGGCACATGGGCCTGGAGCAGCTTTGCGGTGCCCTTGCCACCCTCATCGCCATAGATCTGCTGCACAAAGATGCTGCCCGGCTCGGTGCCCTCGAGCAGAGCAGCCGTAACCTGTTGCTGCTGCTGTCCGGTGATGGTGTATCGCTGATGCTGCTGCTGCAGCTGCTGCTGTGTAATCTGCTGCTGCTGCGGCGTCTGTGGCTCCTGCTTCAGTTGCATGGGTGGACGTAGGGAGCCGGGCGCCAGAAACATGCCCTGTCCCATATACTCCACTCCGGCCAGGGCCTGGTGTTGCTGATAGGCGGCTGCTGTCACCAGATGCTGCTGATCCTCCGCGGGCTGCGGGGTGCCTGCCTCGTCCGTTGTCGTCGTCGTCGCTGTGGTGGTCGCCTGGTTTAGATTGATAGTGTGTTCGTTAGTACAATTGGCTGCCGCCGCTGCTGCGGCTGCTGCTGCAACAGCCAGCACCTGCTGCTGTTGTTGCTGCTGCTGTTGTTGCTGCTGTTGCTGCTGCTGCTGCTGGTGGTGGTGCTGCTGGTCCGTTGACGACGAGGAGGATGTCGGCGTTGAGACGACCACCGACGACGAACCACCGTGCACCACAACATGCTTCAGTACCTTCTTCTTTTCTCTGACCTTTTTGGCATAATCGTTCAGCTTTCTCAGTCTTTCCTTCCGCTCCTCCGGTGACTCATTGGCGATCCTTTGGCGCGCCCTTGCCGCCATTTCTGCCAGCCGGAGCTTTCGCTGATCGTTCGTCTCGCTGGCGCGATACATGCGCATCCTTTCGGCCAATTTGGCCAGCCGTTTGGCCCTCTGGTCCGGCGACTCCATGGCCCGGCGTAGCCGTTGCCTGGCCGCATTCCTCACTAGCCGCATGGCCCGCTCTATGTCGGATTCATTCTGGCGTCTCTGGCGATTGGCTTCTGCATTCCGGAGTAGTCGCTTGCGATACTCCTCCTCGCTCTCGCGCTGCCGGCGTTCCCGCATCCTTTCAGCATT


Search Again