CR00458

CRIMIC CR00458

Gene CG14414

CG14414

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78916

Images

Construct Sequences

sgRNA sequence
GTAATAAATATCATTCAAGGCGG

Amplicon 5' Amplicon 3'
TGCCCCCTATCGGTTTCAACTCCTCAAACTGATGCAAAAATGCGGCGCCATCGAGAAGTTCGACATGCTGTTCCACAAGGGCGGTCCCATGGTGGGACAATCCAGGGGCTACGCCTTCGTCACCTTTGCGCAGGTGGGTGCAGTGCCTCATTGGCGGCAGGCGGTGCAGCGGCTTTAATCAAGAAAGGATCAAGGATTATTGTGCTTTTTAACTTGGCTATTTTGGTATTTAATCCTCAGTATTCTCAAGCTCATTTATGCAGTGCGGCGAACTCTGTATCTATACTCGCAGATGCACTAGCCTAAAAACGCAGCTATGTTATTTTTATATCTGTCACCCATACAGCAAAAGGGTACACGACTTGCAGAAAAGTATGTTCAAGAAGAAGGACTCTTTAAAATGCATATATACATCACTAACTATGTATATATATCATATAGATTCTATAGAATTTGTTATGTACAATGGTTTTCTACATCTTAGCTAGGAAAATACGCAAGCAACAACTTTAGAACATTGTCTAATAACCAGATATTAAGAATCAATTACATATGCTGAAAGTTATCTTTTAGGATTTGTCATTTTATAGTCAGCTTAAATATGTGGCTGCACCGC CTGCACCGCCTTGAATGATATTTATTACTTAGCTATTCCCACTCACCAATCCCAAAAATTCACTCCAGAACGAGGGAGCCACCAATGCGCTACTGAAACTGGACGGAACCAGCGTGGGAAATCGCTCGATAGCCGTGCGTTTGGCCAAGAACATTAAATATGTAAGCAAAGACCTTCGAGTCACCAAGCTAGCTATCCAAACTTCAAATCGATTCTGTTTCCTATATATATATAGGATGAAACGCAGAAGCCAAAGCCGCGCCTGGATATACCGGCCTTGGGCACAGGTAAACGCGAGGAGAAGGTCAGCAAAACGGAGGCCATTCGGGCCATTGAGGCCAAGCTGAAAATGTTGGAGCGCCAGACAGACGACAATCTCGAGCTGAATACAGCGGGCAGGGGCGAGGCCAACGTGCCCTTCATCCAGCGCTATCAGTTTAACAAGGATCGCGACGGTTCGCAGCGCTACGGAAAGTCATCGGCTCCATATCATCACCAGCAGCGTCCCAAGCGCCACTAGGCTCAATCGACCCACACTCGACTTTG


Search Again