CR00456

CRIMIC CR00456

Gene AstCC

CG14920

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 long band OK80584

Images

Construct Sequences

sgRNA sequence
TATGCCAGGTGCACACTATTTGG

Amplicon 5' Amplicon 3'
ATCCGGATGGTTGGATACGCCGGCTACCAGCTGGGGAACCCGAATGGGTGGACGTTCCAGATCGATCTGCGCCCGCTCTTCTCTGAAAGCTCTTTGGCATTAACTGAAATTTTCTTACACATCGCGCTGCTAATTTTATGTCTTATATTGCAATTTAGGTTTTATGTTCCAACTTACTGTTTCGCCAGTGGCGCGATTGATCTGGTTCAAATCTTTGAAATCATAATCCAACAATGTTCCCGCATCGTCGTCACTGTACATGCCTAAAAGCAAACCACGTTTCTTAGATCTAATCCTTGTATGGATGTAGTAACAATCACATACCATCCTCCCTAGCTTGATGATGCTCCATTCCGTTGTGCGAATCGCCGAATTTGCCACTTAAAATGTTTCTATCTCCGAAGAATTCGCCAATTCTTTGTTCACTTCGTTCCTGTTCGAGGGCATGATGCAAAGCAACCATAAGACGATCCAAAAGTAATGCTGCACGCTTGGGAACCACCATCTAAAAGTGTATAAATGAGAAAATTAGGTATTTGGAAAATGCGTCTTGCTTATAATTGATAAGTGAGCTTTTCTTAGAAACTTCTGTCTGTACTACTGTAATTTTCAATTAGTTAAATGTTTTCTTTTTTCGAGGTCTTTAAACCCACTTCCCACGCATCCCAAACATGAGCCCACGGAATATTTAATTTCTGGATAAAAGTGCTTTCGCCACAGTCTGCCCTCGTTAGACACCAAC CCAAATAGTGTGCACCTGGCATAATCAAAGTGATGTGACGTCAGCTCGGCTTTCAAGGGGAAATATAGCTAGGGGTCATAGTCGAAAAGCAATCAAATGAAAAATATACAATTACAAATTGTGTGTAAGTTGATAGGGATTCAAAACAGGCAGTGACCAACGCGACCCACGCGAAGATTCCTTCTTAATTTTTTTCGCTTTATAATTTTCGGAGATTTTGCTTACCGGATACTCGTCGTAGCCCTCGTCGGCTGGGGCACTAAAAATCTCCTCCGGCTGACTGGGGGCCGACCTGGATCCACCCGCTCGCTTGTCATCCGCCGGTGTGTTGGCCTCCGGCAATGTCACCTCTCCGGCTGCACTGCCGCCGATGGTGAGCAGCTTGTCGGGGGATCGTTTGTCGGCGCCCGGATACACCATCAATTGCCGGCACATGTGCAGCTCAAAGTTCTGGATGAGGACGAGCAGGATAATCAACATGGCTGGTAGGTGATAGGTTCTGCACAACGGAGTGCCCTCCTTGCCGGCAAGACTTGTGCAACTTCTCCGCCTCCTGGCAGTTTGGCGACCAGGTGGTTGATGCATTCTTGTGTCTACGGGCGGGAAACTAATTAATGTCAAGCCTGTCCTGCGTTGAACACTTTTGAAAAATCAACTGAAGCGTTGGCTTTATGCGTTCGACGCTTTTATAGCAGCCAATTCCTTGGCAAATCACTAGTTTTTTTTTTTCTTTTGATTTACTTTTTTCGTCCTGCTACTGCTTTTTTACAGTAATGAAGCATTATAGACGCTTGTTAATCGGGATGGAGCTGGTCCAACAGTGAAATGCTTTTTTCATACTTTGATTTACGATTGCGGCACCCACTCGGCGTCCTTGTTGTTGCTCCTTGGTTGCGGCTCTTGCTGTAATTACTGAACATCAAAATCCATGTCCTGCCTGCA


Search Again