CR00454

CRIMIC CR00454

Gene Dhc93AB

CG3723

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK no band80583

Images

Construct Sequences

sgRNA sequence
TCTAGCCCAGAGCCAACTAAAGG

Amplicon 5' Amplicon 3'
TATGCTAGTGCGCCTAAGGCAAGTCTACTTAGGAGGTGTTTTATTATGAAAACGGTGCACTCTAATAAATAAATCGAAAGTCAAACTTGGAGTCTACGATAAAACTTGGTACATTGGTCTAGCTTATGACTATTATTGTTCTACGTTGTGAACTAGAAAAGAACTACGAAATCGTTTGAACTAAATTAAGTTAGATAACTAAGTTAAGTTAAGCATTAAGCAGTTAGCCATTTAGGTTTGCAAGAGCAGCGCTACGCCGGCCAGGATCCATTTGCCTGGCTTGTCTTTGGTCTTCAGATTCAAGTTGGACACATAGGTGGTGGGGCCTCGGGTGCGGGTCTTGTAGACCGGGCACTCGTACATGTTCCTCAGATCTTGCTTATCTTGGGTGATTGCCTGCGGTACATAGACGAGGTTAAATTGAATCGGATTCGCATTCAGTGTAGTAGAATAATGGAGTGGAATCTAGTTTTCGAATTTATGCCAACATGCGCCAGCAATGAGACGCCACAGATCCGCCCTCGATTCGCCGATTTGCGGATTTTAGCATTTGCCCGATTTGCATTTCCAACTCACCCGAATGTTGATCACCGGCATGGATGGGTAGAGCTCCTTGAGGCGCGACTCCATGATGATACCCTGCTGTATGTCCCACCTGGCGCCCTCCATGAAGATCCCATGCACGCAGCAGCCGTCGCGCGGTGCCGTCCTGCAATTTACAAGATCATCTCAGATGCCGCGACTATAATCGTAGCTATAGATAGCCACAGGTCTAGCC GCGGGTGTCGATGCTAATCTCCATGCAGAGATGCATATTAATTCCGACGACGGCGCGACGGATCTCCATTGTTCTCCCACCAGCGTCGCCATGTGAAACGTGGCTGGCGGGGCGCCACTTAATAAGCAATCATCTCATCAGCCGTTCAGCCCATCAGCTCATCAGCCCAATCAGTCGTTGGGTAAATAGACAATTGTAATTTGCGGTCTATTAATAAGTCTCACATATTTATATACCAGTGCTGGTTTAAAATTAGCTCTTATGAAATAGCACTGTGCCTATTTTTAGACACACTCGCTGGCCATTGGCCGCAGCTGGATTTTTTCCAGCTTGGAGGCATGATTACATGTCACAACATTACATTCATTATGCGATTGGGATTGAGCTCTGAGCAAATAAGGTCGAGCGGACCATTAGATTATGTTTGGGGAATAAAATTTTTGAGCTAATTCATAGATTTAGTGATTTCGTTTCACACTAAAATGTTTAGGGTTTAAACAAACAGAAACAACTCAAAGTTGGGTCACCTTTTAAGAAATATAAAGATTTTTTCTGGGCCCTAGAATTCCAAAGATTTATCTCTTTGATAAAATGGCAATGTTCGTGCTTTTCTTAGAATCTGCGACTATTGCGAATTTGAGATTGCTCATGATAGTGTAAACATTCCCGGGAAGGGGTCACCTCAAGAGTCAATTGAGAATTGGCGTGGCAATGGCAGCGGCACTCACGTAAATTCCTCCTTTTGTTTTTTGGTCACGTCACACTGGAGGCACATCT


Search Again