CR00452

CRIMIC CR00452

Gene sr

CG7847

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78915

Images

Construct Sequences

sgRNA sequence
GATTAGTTGCGGACTCCATGCGG

Amplicon 5' Amplicon 3'
CATAGTCCCACCTCATCGGCCGTCGAGCAGGTGGAGGCCCACAAGCAGCTGATCGAGGCGCTGCCGGGCGACCTCAACACACCGGTGACCACGTCCAGCGATATTCCCTCGTTCTTCGGACCCACCACCGTCGTGGAGCCACCGCCCATTACTGGTGAGTACTAAAAACTATGAAATACTTGGACTGATAGTTGCATTAAGAGAGATCTTATAAGAATTACATTACATTACAAAACATATAAACATATTGAAATCATTTTTGTTGATCAGTTCGCTAGTACGAATATGCAGAGTTAGTAATCTTAGCTTTTTATTCATTCCATAAATACTCGTATCTCCTTAGAAAGGAACTACCGTAGTGGAGATAATTTAGAACGTAGCGAAAGTACATATATATTCCTTGTCAAGATAGTTCAATATTGTAATACGGCCTATAAATCGTCGACACAAAAGCCTCAAAACATTTATAGAGTTTTGCCTGGTGGCTGCGCCCCATCGTCTGGTAGGAAAAGTCGGACCGTGAGTTTTCTTTATCTGCTGCTAATGGATGCAGCTTGCAGCTGCCACATGTTGCAGTGGCAGTAGTGGCGCAGTTGCA GGAGTCCGCAACTAATCCGTTGTCAGTCCTAAGTCTCAACATAAATCAGCTCGAGCGGAGAGCGCAGAAACTGTCGTTATGTTGGCCCCATATCTTGACTTACTTCTGCGCCACTCCAAAGTATCTCGGCTTTGTCTTTCACCGGACGACTTACCACAACCTTTTCTCCATTCGGCTTGCCCCCTTGCCCCACAGCGGCAAGTTCAAAATCGAAAATAAACATTCGAAAAATGTTGAAGTACCAATTTTTTGAGGCATTTCTTTATTTGCACGTCTTCTGATTTGTTGATCTTGTTTTTCAATTTTGGATTTCTTTTTTTTTTCATTATTATTTTTGAGATTTTGTTATTTGGTGTGTGCGTTTGCCGTAATAAATTCGTTTCGTATTATTAAGTTATGAGGCATTTAAAGCGGCCTCCAGCCAAGAGTTTCATATATACTTTTGGTCTTTGCTCACATAAATATAAATTAATAAAAATGTTGACATCCCAATGGCTATATCGCCGTATAGACTTCACAAAATTTATGTCATAAAATTTTCAGTTTTATTTTTGCGCTCACTTTTCATTAATGTCAAATAAAATTGAATTTTGCAATGATCACGGCGCAGCGTTCTCATATTT


Search Again