CR00450

CRIMIC CR00450

Gene CG7430

CG7430

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band OK80582

Images

Construct Sequences

sgRNA sequence
TTGCATAACTTGAGGGGCGATGG

Amplicon 5' Amplicon 3'
CAGATTTCGGGGGCAAGTCTCGCCATCTTGTTGTGTCCGCGAACCAGTGTGACCGCATTGCGACAGCTAGCGAAATACTGAGGCTTCAACGAAAACGCGAGATGAACGCGACGTGAAAATACCAAAAGTGTTGTGGGAAATATCCCAGATGGGGAATACCACACAGGGTTGTACTGTAGGGCAAACTATCGAATATTCATCGTATAATACATTTTTAATTACCTATAGATATAATAAAGTTAATATTACTTTGGAACTCTTATTATATATGTATCGTATGTACGTTGAGTTATATATTTTTAAAACAGTTATTTTACAGTTTATTTATTACAGTTTATTTTATACGTACAAAAACATTAATTAATGGGTGCCAAAACTATAAAAGCCGGCTTACACGTATAGTTGGCTTGTTTTTAGGTAGCTTTTGCTACAACAAATGACCCATAAAGTGAATATTGTATAAACTAGCAATTGAGTGACGGACATATCGTATTTTGAACGATCATCAAGCTAATATTTTTATACACATCTTTTTCATACGAAAATGTTTTAGAATTTCAAATTCCAACAGAGTGGAAAATCACCAAAACAATCGATAGCATCGCGGCCATCATATGACCACTATCGAATGCACATCGCCAGCCCTGCGACCGCTCCGAGCCCCACAACACGAAAAACAGTCGGAAAAACACACATCAAACTAGTGTTGTGTTTGTAGTTAAATAACGATTATCCTCATAACTCGCCCGCACCAGCCATGCAATTCACGCTCCGTCATGTTGTTTCGGCAGTAGCCAAGGTAAGGATCGGGCGACATAACCGATTCCCCA GCCATCGCCCCTCAAGTTATGCAATCTAACCTCACCGAGGGGGTCGAGAAATGGGCAGGAAAAGGCTGGAAAATGCACTTGGATCACCTGCAGTGCTCATATGATCCCGGTGGGTGATTCACTGGCGTTTGGGGATTTGTTTGGCCCCGTTTTCAAGGTCGCTAATTAGGCCAATTATCAGCTGATAGTCGGCCGAAGATTAGTGCGAAATGCGTGCGACTGGCGTGATAAATGATAAGGTGCCACAACATGTAGTAATCTGCCGTCTTTACAGACTCCTCTGCGCACCAATGCCGCCATTCTGGGTGCCCTCAACGCCCGCTGCTACTCCAGCACCCACGAGGCGGACATCGTGGTGATTGGCTCCGGACCCGGTGGCTATGTCGCCGCCATCAAGGCCGCCCAGATGGGCATGAAGACGGTCAGCGTGGAGAAGGAGGCAACTCTGGGCGGCACCTGCCTGAATGTTGGCTGCATTCCCTCAAAGGCGCTGCTGAACAACTCCCACTACTACCACATGGCCCACTCCGGTGATCTGGAGAAACGTGGTATTAGCTGCGGCAGCGTTAGCCTGGATCTGGAGAAGCTTATGGGTCAAAAGTCCAACGCCGTGAAGGCTTTGACCGGTGGCATTGCCATGCTTTTCAAGAAGAACAAGGTCACACAGCTGACGGGCTTCGGCACCATCGTCAATCCCAACGAGGTG


Search Again