CR00449

CRIMIC CR00449

Gene bsf

CG10302

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 short band OK79261

Images

Construct Sequences

sgRNA sequence
ACTATGTGCTCATCCAATTTTGG

Amplicon 5' Amplicon 3'
GCGCGCATGAATTCCAGAATCCTAGTGGCTCCTTCAATGTCTCCCTGCTGACAATAGCGAGCAATCAATCGCTGATAGGTCACCCTATTGGGCTCGATGCCCTTCGCCTCGATCTCTGCCAGAAAATCGGTGGGAGCAAACCCATGCTCGTTCTCCAGGTAAACGCGAAGCAGGGCATTGTAGTGCGAGATGTCCATGGGTACATTCAGCGCATTCAGCGTCTTCCAGATCTCCTGCACCAAGGCAGTTCTGACCTCGGGAAGCTCCTCCGGTACCAGGTTGCCGCAGCAGCGAATCACCAGCAGCGATTGCGAGCTGGTGGCCGTCCTGTGTGAGCGGATCTCATCGAGCACCTCCTCCAGATCGCGTCTGGAGATGCGCCCAATGCGACGAACATCCTGGTCCAGCCGGCGAATCTGTTTATCCAAACTCAACTCAGCTTTGGCCGCCGCATTCGTGGCAAAACCACTAGGAAGATAATTAAAAATAAACTTAATTAATATATAAAGATATATGAATTAACAAAATCCTAACGTCCTTATAGATTATTTTCCGGCTGACCTTAATGAGAAACTGAGTTGTTATAAGATAATCGTGTTGCTTTTTGAATAAAAATAAGATATTTAGCTTCTTTCTACATATATAACTAGACTTTCTACAAGAAAAACGCTCGACTAAGGCCA GCACATAGTAGGCGCTCCAAATCCGGATGAGGTTATGTAAATATGTGAGACATCAGTCGAATGCAACTGCGATGATCCCAAGTGGCGGCACGTGCGCCTCTTTTCGGGATTCAATCGCTGGAAAGTGGACGATTCCCCACTAATCACGTAAATACATGAGCACATTGCGTAATGCCGGCGATTTGGGGCCAGATTTTACTCACTTTTGGAACTGGCCGCACATGCAGGGCGCATTGTTCAGCAGATTGCTCGTCTCGTTCTCGCGAACCGAGTTCACCAGCACATTGCGTGTGAAGCCGGCGAAGTAGCGCAGCAGTTTGCCCGTCCTCAGGATGGATGCCATGGCGGAATCGTTCGGTTTTAATTAATAAATGAGCTTATTATTAAAATGACGTTCGCACGAGTGCGGCTGAAACCGATGTCTCTTCGCGCCTATCGATGTTTACCTGCGACAATCGATTGTTTTCGGTGGGACCAAAACGTTCAAATCAAATGTATCAGCTTAGCGGTGACACAAACGAGAGGATATTTGAACAGTGCCTAAGCCTGTCAGCTTAACCGATTTAATTTGCTTTTTTTCGGATCGGAAACTCTAATCGTACCCCGTATATACTTGAACTAAAATGTCTCTGAATCTGCAGTACGAGGACATTGGCAAGGAATTTGTCCAGCAGTACTACGCCATATTCGATGACCCGGCGAATCGGGAGAACGTGATTAATTTCTATAACGCTACCGACTCTTTCATGACCTTTGAAGGCAACCAAATACAGGGAGCACCCAAGATTCTGGAAAAAGTTCAGAGTCTGAGCTTTCAGAAGATTGCCAGAGTGATAACCACAGTGGATTCGCAGCCAACTTCCGATGGCGGAGTTCTGATCATCGTCCTTGGAAGACTAAAATGCGATGACGATCCCCCACATGCATTCTCGCAGATCTTTTTGCTGAAGCCCAACGGAGGATCCCTCTTCGTGGCTCACGACATCTTCCGTCTGAACATCCACAACTCTGCCTAGGAGCACTCCAGACCCATATGTACACCACACATAATCGACATCCAAAGACGCCCAGCGCCTAATAGTGAT


Search Again