CR00448

CRIMIC CR00448

Gene DAT

CG8380

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK short band79260

Images

Construct Sequences

sgRNA sequence
TGCTGCCTGCAACTCGGAAGTGG

Amplicon 5' Amplicon 3'
ATCCATGACGCTCGTCTCTGTTGTTGAAGCCATAATTTCCGTTGCTTCAAGTGCATTTCCACCATTTTCCAGCAGCTCGTCGGAGACACTGTGGAAATATGTGCCTCTAATTCGATTCCCATCCCGTAATTCGGTCAAAACTTGTCCAATTTTAAACGGCCAAGTGTTGGTTATTGCTTGACTAGCAAATTGATATTCTATTGAATTATTGAAAGTTATGCCTACTTAAATGCTTGTGAATAACTTTTTACATGTATTTGTGTAGGACTATTCTGGTTTAAGCTGAGGTGCAAAGTCTCACCATTAAGTCCTTCAGTTCCAAATAGAAATCTAAACTTTTAGACAAATTTAAGAATAAAGAATATAATTTATTGAAATACATAGTTAACCCAAGTACAATCAAGTGCGTATGCGCGATCTTAGTTTGAAAAAAAGCCAGGCAGCTCCTTGAGTTTTAGCCCTAATCCAGAACAATGTGGATGGCACAGCCTGTTGCTGCCACCAAAGCTTCCACTTCCGAGTTGCAGGCAG GGCAGCAGGAAAATGGGAAACAGAATAAATAATACCGACTAAGCTGTGGTAATAATCGCAACCTGAGCGAGTTGCTGCCCCTGGCAACGGACATAAAATGGAACTTAAGCTGAAGATGGAGCTGGAACCACTGATTGAACGCAATGAAGCGTATAAATATAACAATTTATTATTATGATTTTAAAGCAGCAGCAGCAGCAGCGACCGGGGGTTAGCAGGAGGAAAAAAAGAAAACTCATAAAATAGTAATAACTATATCGAAGGCCCTGTGTGCCACATCCATTCACGACGCATCAGCGGGAAAGTGCCGCAATCAGAGGGAAAATGGGGAGGTGGAGACATGGAGACATGTTTCGCACATGAATTTCCCACAATGCGATGGTGGAAAGTGCTCCAGCAACAAAAGCCTAGAGAACTCCACATAAGCAGGCTGACATATTGCCAAGAAAATGGGGTGAAAAAGTGTGACAGAGGGTAAGCAGGCCAAATGCGATTATGACTGCCAGATTTAGTTGTCATACAGAAGCACTTAACTTTTGGAATTGTTTTGAATGATGGCGTCGGCGATGAGGATCAGGAAGCGAAGTAAGTGTTCGACTGTGTGTCCTTTGCCGCTCTTTTAGCGGGGAAAAGCCCTGCAATTTGACAAAGGAACCATTCCCGCACCACCCCACCGACAGCACTTCGCACCACTTTGACAAAGTGTTAACAAGGCCGAAAGGGAAATTCAGAAAGCGGAAAGAGGAAAGCGACGGGTTCCGTGGCGAGCCCAATGATGTGTA


Search Again