CR00446

CRIMIC CR00446

Gene Dsor1

CG15793

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78914

Images

Construct Sequences

sgRNA sequence
TGAGTAGGAAACCGAAAACGAGG

Amplicon 5' Amplicon 3'
TTTCGCTGTTCCTGATCCCCGTCAGCACGAAGATCATGATCAGGACAATGGCCGATCGCATGTTGACCACAATGCACTGTCGTTGGAGCCTCATTTTGGTCAGATAGAGCGGGGAATACGCCGGAAATGTTATTGTTTTTCCCTTTAAGAAAATGAGTGGGGTGGGAGAGTGTGACCGTATACGCGTGGCATGAAAATATCAACCGCGAATGCTCAGGAGAAATTTCTTTAAAAAGCGTATCGAATAGTTTATAGATATGTTTTGGCTCAATTAAATTGGCTAAACAGATAAGTATACCTCTCCCCTCATCGTAACAAATTAGTAATATCTAATCCTAATATCCTTTCCATTTAAGTTGTGACCATTGGCCGCTTTAGTCGTAGGAGTGTATTAACGGTATTTGGTAATCGCGACATCTGGCCATACCGCACCGTCTGCGAAAAAAACCCAAAAGTCGCCGATTTTGGCTGATTATTGCAAAAATAATATTAACTATCCGTTTGCTGTTCGTGTGCTCGGTTCGGGTGTGTTAAAGTTAAGCGCAACGCGAGGAATTGGTGCAAATTTACCAGCGGCTGGACACACAAAACGAAACATTCGCACTTGGCCTCCCTTCGCACGCCCCCTCGCCGACGCCCCTCGCCCCTCACACCCTTCAGCCGTTCGTCGGACGCCGCTGTTCGTAGTGCGTTTTGTTGTTGTTTCCACTGGAACACTCTCTATTTGTATTGTTTCATTTATTAGTTTTTTTTTGTTGTTGTTATTGTTGTGTGCTTTAACTTATCGGTAACGGATAACGGTATCGAGAGATATATATTATATATAGTAAGATGTCGAAGAACAAGCTGAATCTGGTGCTGCCGCCGGTAAATACGGAGGCAACTGTTGCCGCCGCCACAGTGGCGCCGACGCCGCCATTCAAAACCCCCTCGGGCACAGAGTAAATATTATACATAATATCCTTAATAACTGACTGGTTTTTAGGCCACCCATTCCAATAACACCGCATCCCCCCTCCCTCGCTGTTTCCCCTTCCACTCC TCCACTCCTCGTTTTCGGTTTCCTACTCAGTGGTAAGATAATCCTGTAGTTTTGCGAGTTAGGTGGGTAATTAATATCCATCAATTGATCCAAGGAAATCCCATCCAGCTGGAAAGAAAGAGACAGTCGGAGTGAAAGAGCAGGTACTCTCTCTTTGTTTGTTGGTGTGGGTGGTGCTCCTTTCGTGTGACGCACAGGTACACAGCGAGAAAAAACTTACTGAGTAAATACAGTAAACTGTTTTAGTGCTTTTTGGATTAATTAACGGGATGACAAAGTCAGTTTCGAAGATAAATAGAAATTATAATTTAATAGTCCTACCTTTATCGTATATTTTTTTGTGAGCACCAAAATGTAGGCAACATAACATAACACAATACATATGTAATTTGATGTGTATGTTTGTGTAGTTTTCTTATTATTAGGAGAAACTTCGGCCCGCCCCTCATCCCATCCCCCACTTTCAAATCCCATCCATTGCTTGCACTTTTTACATTTTCGTTTTGGATCGCAAAAATTCATTAAGAGGTTAAATTAAAGCACACACAGTTTGCTGGGGAAGCCCAAGACGAGCATCGATGCGCTGACAGAGACGCTGGAGGGTCTGGACATGGGCGACACGGAACGCAAGCGGATCAAGATGTTCCTCAGCCAGAAGGAGAAGATCGGCGAGCTGTCCGACGAGGATCTGGAGAAGCTGGGCGAGCTCGGATCGGGCAATGGCGGCGTGGTGATGAAGGTCCGGCACACGCACACACACCTGATCATGGCCAG


Search Again