CR00440

CRIMIC CR00440

Gene Alg3

CG4084

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78913

Images

Construct Sequences

sgRNA sequence
GATTCCGTGGATCTGCCCGGGGG

Amplicon 5' Amplicon 3'
ACACGAACAAGGAGGATCCGGATGCGGGCCGCAAGTTCCAGGAGGTCTCCGAGGCCTACGAAGTGCTCAGCGACGAGCAGAAGCGCCGTGAGTACGACACCTATGGCCAGACGGCGGAAAACATTGGTCGCCAGGGCGGCGGATTCCCTGGCGGAGGAGCCGGTGGCTTTGGCCCCGAGGGTTTCTCGCAGAGCTGGCAGTTCCGCTCGAGCATCGACCCCGAGGAGCTCTTCCGCAAGATCTTCGGCGAGGGCAACTTTCGAACGAACTCGTTCGACGACTTCGCCGACTCCAAGTTCGGATTCGGCCAGGCCCAGGAGATGGTCATGGACCTGACCTTTGCCCAGGCGGCGCGCGGCGTTAACAAGGATGTCAACGTCAACGTGGTGGACCAGTGCCCCAAGTGCGCCGGCACCAAGTGCGAGCCGGGCACCAAGCCAGGTCGCTGTCAGTACTGCAACGGCACCGGCTTCGAAACGGTGTCCACTGGGCCCTTCGTAATGCGCTCCACTTGCCGCTACTGCCAGGGCACGCGGCAGCACATTAAGTATCCGTGCAGCGAGTGCGAGGGCAAGGGCCGCACGGTCCAGCGCCGCAAGGTCACCGTGCCGGTGCCGGCTGGCATTGAGAACGGGCAAACGGTGCGAATGCAGGTGGGCAGCAAGGAGCTGTTCGTCACGTTCCGCGTGGAGCGGAGCGACTACTTCCGGCGCGAGGGCGCCGATGTGCACACGGACGCGGCCATATCCCTGGCCCAGGCGGTGCTGGGCGGCACTGTGCGTGTCCAGGGCGTATACGAGGATCAGTGGATCAACGTGGAGCCGGGCACCTCGTCGCACCACAAGATCATGCTGCGCGGCAAGGGTCTGAAACGCGTGAATGCCCACGGACACGGCGATCATTACGTGCACGTCAAGATCACGGTGCCATCGGCAAAGAAGCTGGACAAGAAGCGACTGGCTCTGATCGAGGCGTACGCCGAGCTGGAGGAGGACACCCCCGGGCAGATCCACGGAATC CGAATCGCAAAGACGGCAGTAAGCAAGCAACGTAAATAATCTCCCGATCTACCAATGCAATCTCTAAATGTAACTTGGAGCTTGAATTCGTAGTTGAAATATACGTGCGTTCTATGTGCGAGCTTTATTAAATGATGGCGTCTTTCTCTCCCCTTCCCCATCTCTCGTTGCAGCGCAGGAGCGAGTGAGGAGCCAGGAGCGGGAGCAGCTGCTAAAGCCAGTGCAGCAGCCGCCGGATCAGGAGCCTCCAAGCCAGGACCAGGAGCAGAAAAAAGCGAAGGCAAAGACCAGTGGACGGACAACGAGAAAACCAAAGCGAAAGAAGGCGGCGGATCCGGATCCGGACAAGGCGACGGCGGAGGCGGAGGCTTCATAAGCAAGATCAAGTCCATGTTCAACTGACAGGCGTTGGCAACCCGATGGCCGATTCTGTTTTTTTAGTGTCTAAGTTAACGCACGTTATTGTTGCTAATCTAAGTTCGGGCGGGAACCGGGGGAGTGTATTCCAAATACGACTCGGTTCGAGATGAATAAACCAAATTGACCGTCAGTCGGGCAAGTTCTGCGTTTAAGCGAGGCTAACTTCACTTGTCTTAATCTCACGCTGCTCCGATTTTCAGTTGCCTAAAGTTCGTGCCGCATTTGATGTCGTCCAACTCCCCAAATCTCTGTGTTTAACCTTTGATGGTAACTGTGTTCAAACATTTGAACCATATGTCAAACTACTCTCCTCGATTTTGAAAATACTTCAAACTTTAAAGTAACTGAAATATCAATTTTATAAGAATTCCAACTAAAAAAGAGCATAAACTATATAGCTAGTTGGAAATAGGCTATCCCCTTAGTAAGGTAACCTAAAATATCGTTATAACCACATCATGCGAAGAACAACAGGTGCACGCATATGTTTCCGCAACCGGAATGGGGTCACCTGTGGCCAAAAATAAACCAGGAGCGGCGCAGAAACTCACCGCGCAACAGACTGTAGTTGGTGGTGCCGTTCAGGAAGCCCTCGCACTCCTGCATGTAAGCCACCCAGTCGATCTCTGTGTAGGGCACCCGCTGGATGACCACCACGTTGATGACCAGCTCCGCCAGGAGCACGAAGAGGCCAACTATGGGCAGAGCGGCCGGCTCCAGGAGCAGATACTTGAAGAAGCGCACGTTGAGGTACTT


Search Again