CR00439

CRIMIC CR00439

Gene CG1358

CG1358

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78912

Images

Construct Sequences

sgRNA sequence
AGTGATAGCCATTTAATACGAGG

Amplicon 5' Amplicon 3'
CGTCGGGCGTAGACTTTGTAGCCTAAGAAATAGAAAGTGGAAATTGAATGCCAGCCAGGTGAAAGCCACTTCAGAGTGCTCATGACGCGGCCCAAGGCTCCCCATTCCATCGCATCGCATCCGACCATCCTGCGGAGGAGGACCCCGTGTAGAGCTGCACCGGATTAACTGGATCAGGGGCCGGGATTACATATACTACTCACTACTTCTTCACTACTTCCACTCGCGCCTAAGGCCTTTTCCGAAGCTAATATCCATGCAAATGATGGCGCCCACCACCATCGCCCCATTATCGTAACAAGTTAATCCGCCCTTTCTGTTTGCCTAGTGACGTCGCGGCCTTGAGGGTTTTTCGGTACTTCTCTAAATTTCCAACTTAAAGGCCTCCAATGGCAATCTTGTTAGTCATACTAGCCAGCTTATGTCTCTAAATTTATATGGTATTATCATTATCCATAATAACGTTTGAAGTTATACAAAATTTCAATTTATTGAGTAATTTAAATAATTTTGTTTTGCTGCAATTATTTTGTTTTGAATATATATTTAATGTGTGATTCGTGAGCAAAATATCCTGAATAAGATGAAATTAGGCCCCATGAGGTTATCCTTTGGAAAAGGTTTCCTCGAAATTTGAAATTATTGGTCGACTTGTTTAAATAGCTTAATTATTTTCGATTCATGGACACCGTGATTTTCGCTAACGAGGTTCATTTAAGCAACTATTTTTGCTTTGACCTAAATCGAATTTGAATAAATTTCTGTTCAAATGGAGAGGAAATCCTTGGCTTTAAAGGCATTTTTGATTCGGCCATTTGTGGGAACGTTCAATTGTCCCAGGAGATCCTTATGATTAAAATGTTTGATTACAAATAGAACGGGTGTGATCTAAATGCACAGCTATTGAAATGCATTTAGTTTGCACCTCGTATTAAATGGCT TCACTATGGAATCGCGTGCATCGGATTGCTTATATATGTATGTAGTATATATGTAGGCTTTGGTTCTATTTTTAACCATCTTTCTCGTTCCAATTTGTGACAATTCACAGGCGACGTCACTAACTTTTCGGCTTGCATGGCATTGAAAGTACAAAACGCTTTGATGCCCTGCTTTATTTGTATTTTTCAGTTTTCAGTTAAAGCACGTGTATGCACAAACACAGCCAGGTACAATGGCCACACATATGTTTACAGTGCACAGGAAGAAAAATAGGGTATTACTATTAAAAAAATAATTATTTAAGATGGCCCAGTGATGTAATTAAAATATATAGATGAACTTCTTCAGGTTCACAGAAGAGTTACAAAGTTCGATTTTGTATAAAATACATTTGCTTATGTAGATCTTGTATTTTTAGTTCATAGTTAATCAAAGGTGAATCTTTTTTCTTGCAGTGCTTGCGGCTGGCCTGCTTTTAAGTGAATGTGCGGCTGTGGCTTTGGTTTTGGCAGGCTCGCCGAGTGCATTTGTGTGTGGTGGTTGTGTGGTGCCTGGATTGCATACTGCACCCGAATGCCAGCTCTTCGCACACCCACACTCTTACACACCCGCACCACGCACCCATACATCTATGCAGCCGCAACACAATCACAGACACGATACTATTGCCTACCTGGAGGCGCAGTTAGGCCAAACCGCTCGTTCGCGTCCGACATGCAAAGTGCAGGTGCACATTCAGCTGCAGCGGCAAGGCAACTGCGCGACTGTTCGGCTTGAAATGCCAACTAGGCGAGTGCTGTGT


Search Again