CR00438

CRIMIC CR00438

Gene sws

CG2212

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK no band79259

Images

Construct Sequences

sgRNA sequence
GCCATAGGACTGAGATGCTGCGG

Amplicon 5' Amplicon 3'
CACATAGCCCACGTCTCGAATTTCGTCGAAGCTGCCGAAGGCTAGAGTCTTGTACTTATCGATCGGCGGTCGGATATACTCGCAGTAGTCGGAGTTTTTGACCTCCTGCAGAAAAAAATATGTTAATTGCGTTTTAAGTTCGATTTCATGGAATAACGTATGTACCTCTAGTTGGCGTACGCAGGACACATAGGCTAGTCGGGATTGGATGTCCGGCAAGTCGGGCACCTTCACAGGCGATGTGAAGGGATTCCATTTCTTGTAGAGCAGCCACCAACCGCTTAGGTCGTCGCCATAGTTGGTCAGGTCAGTGTCATCCTGGGATCCCACATCGATGGCGATTATGTGAGCAGCTCCAAGATTATGCATCACATCGGCTAAATGGTGGCCAAGGAAATAAAATGGCCAGCATGCGGGTGGTGATTTAGTTGGTCGATGTGTAGGATATGTTGTGAATGCAATACAAATGTTCAATTAGTTGTGCTTATTGGTTTTACGGTATTGAAAAACTAATTTAACAAATTGCGCTTACAATTTAGTTTTAATATATTGTAATCATTTTTAATTGAAAACAATTTTCAAAATTGATTAAATTCACATTGTAAACGCATTTGATTAATCTTATCCCGCAGCATCTCAGTCCTAT TGGCCAAGTCAATCATTTGTGATATCTGCGTATATCGTAAATTTTTAATTCGAGAGTAGAATGTGTGGATAATTTGATTGAAACTGGATTGGGCATTGGAATAAGATGCTGGGAGACGAGCATCGCGAATTTCCAAAACTGGAACGGACGCAGGGGGCGGCGCAGAGCGTTGGAATCAGGATCGTGCATCGCCAATATGGATGGTGTTTCATTTTTTTTTTTTTTACCTGGCACGTTGTTCGTGTAGCAGCCATCGAGCAGGAGGTGGCCGTCGCGGTAATCACAAAATGGTGGGAAGACGCCGGCAATCGACATGCTGGCGCGGCAGTACCGCCACAGGTGGCCTGTTTTTGTTTTTTTATCACAGGTCGGACAAAACAACAACAGCACAATATTGTGGATCGTATTTTTTGTGGATGACACGGAAACACGTGGGGGATTGCATTGGTTTATTCAATTGGTTTGTGTGTGTGTGTGAGAGAGACAGGTCGCGTGTGTCAAAGATAAAGATAGAGAGAGGGAGAGAGAGAAAGATACACACTTTTATCCACGAAATAATGGTTTTTTTTAGTGCTAAAGCTACATATGAAATTGGTCTTATTTATACGCAAACAACAACAAAATGGTCAAGGCGAACAATTGGGGAACAAATAAACTAATAAGCAACTCAAAATACCACAAAAAAAAACTAAAATAGGTAGAGGATAAACCAAAGAAACTTTGTGCACTCAATTATAGTTGTGATTCGGTAATTATGTATAGGTATGCGTGTGCGTGTTCGGTGTGTTTACGTGGAAGGGAGTGAGACAGATGGTGCAAACGAATGCTCTTTACCGTTAGAAATGCAGGCCACGCAAACTATCGATTGGCAGCACTGGCATTGCCAGCGCGAAAAACTTTCAAACTCTCAAACATTTAAAACATCTTGTAGAACAAGAACAACAAATATAACATCATCTCATGGATTTGCCGGGAAAGAGGGACCAAAAACGGAACGGAGCGAAGCAAACGGAATGGAACGTGAGGAACGTAGAACGCAGGCAAGCATGATCGAAC


Search Again