CR00432

CRIMIC CR00432

Gene CG30020

CG30020

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78911

Images

Construct Sequences

sgRNA sequence
ATTAACTATCGGGTAGGATTGGG

Amplicon 5' Amplicon 3'
TCGTGCGATATGTGCCTGTTCGAGACGTCCACCGTTAGCCAGTTGCGAACACACTACAAGGAACGGCACACGGTCCAGCCCACGGAGGTGCAGCTGCGTCCCAGTTGGACGGGCGAGCCAACGACAACGAGAGGCGTTGCCGCCAAGCAGCAGACTCCGGCCAAGATATTAAATCACACCGACATCCCGTTGGGCATTAAATGTGAGTCATGAGATCGTTTTAACCAGGGCATTTAAACTGGTATCGACTTTCGCCGGTTTTTTGGACAGTTATGAAATGATTCGCAAACAAAAATTCGTATTAATCTTTTCGTTGGTTGAATGAGTTAATGTTGATATTTATTTATTTATTATTTTCTTATTATTCATTAGGTATTTTACCATACTTTTTGTTGAGCTCTCAACTTACTTCGTGCAATACGTTTTTTTTTATCATATTTTTTGCGGTAATTTTGTGACAAACCATGAACCGAAATTCTACACAACAGTTAAATTAAACGTTTACACTCGAAAATATGTAGATCACAGCAATGAAATTTTAAATTGTAAAATTAGTTGTACATACAAATTTAGCATAACACCGTGTATATCCAGGCTATGTCCTCTTTCTAGTAAATTGATGCTCATAATGATCATAATGGCAATTAGTTTTTTGGCATTAACTATCGGGTAGG TCTCTTTAGCTATCGCGCTGATGAAACTACAAAAACGTTGAGGCCTTTATTCCATGTAAATAAAAGCAAATCGAATACAAGTGGAGGGATTGTGGACTTTCGGTAAGGACTTCAAAGGAGCACTTTAACTCGTTTTTGATAATTAATTGTTTATAATTACCGTGTTTATCTTTGAGTTTCTCCAGCCTGCACTCTAACCAAATTTTATTTAAGTCCAACAGTTTAAATTTGTATACTCATTTGAATTCCCTGGCTTTCCGTTTTATATGTTTCATGTTGGCATGTTTGTAATGCAATGTCTTCCAGATCCGCCTGGTGTTTTGGAAACGCAAGCGCCATTGCCGCAACCGGTGGTACATCAACCAATGCCTGATCCAATGCAGCAAACGGAGCCGATGGCCACCACATCGACGACCATCACCGAATCGGGCGACATCAACGTAGTGGTGGATGCGACGCCGCTCTTCTATGCGGCAACCTCCAACTCCCTGTTAGTGACGAACCCGGCACCGGTGACAACGGTGGAGGAAACCACCGGTACGGCCAGCAACCATGCATTTGGAATCTTTCCCGAAATCTCAGAGGGCAACCTGCCCGTGAACGAAGCCGTACAGCAGGCACCAGCCAATTCATCTAGCGTTTCGGTGTTTGGCGACATGCAGGACTTTATTGACAACACCGATGTGGCTGCCATATGCACAATTCCCGCGGATGGCATGCCCGTTGTGGATGGTGATGACATTGTGATTGATAATAACAATATCAGTCTGGACTTTGATGCCGAGAATTTGTTCGAGGACTTCGAGGAGGAGGAGGATGATACTGTGGCCG


Search Again