CR00431

CRIMIC CR00431

Gene sicily

CG15738

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OK79258

Images

Construct Sequences

sgRNA sequence
GCGGAGTAACAGAGTCTGAACGG

Amplicon 5' Amplicon 3'
TTTCTGACAGACCGAGTGCGATCTGGCAGCACCGCTCAGAACATATGTTCAGTTGTCTGGTGGAAAGAAGAAGCACAGATGCGGCGCCTGGTGCGAAATTGGAATTGCCGATTGTTATTTAACGCCAAATCCGGCCAAGAAATTGTCAGCCATGCCGGAATTCACCAGGAGGCCAAGACCAATGCGATTCCCAGGGAAAAGAAAGTGATTGAGGCGGACAAGAATGGATACGGGGCCAAACATTGCATGAGTCTAGTGGAGTAAGTAGCGCAAACTTGTCGATTGAAGTTATCCGTATAATTGAACATGGATCTATTCCGGATAACCAGGAAATACGACTACGAGAACTACCTGTGCACCTTGCTCCTACCACGGGAACTGCGACGTGCTGCCTTCGCCCTACGGGCATTCAATGTGGAGGTCTCCAGATCGGTTAGCGGCCATGTGAGTGGAGCATCGAAATTCCTTGGGGCTTATTTTTTAAGTTAGAATAACGTGGCGCCTTAAATTCA CAGACTCCGTTCAGACTCTGTTACTCCGCATCAATATTATTGTAAGCATAAGTGGCTTATGTCCGCATCTCATGAATATTATTACCATTTCGAACGGTTTCACAAATCTCTTAATTTCTTATGTACACTGCAAGAGTATAATTTCTCTCCTTCCTTTAAAACGGATAGAGAAATTCGTAGAATAAGCAACACTTCGTAGTTTTTAAACTTCTTATTTCTGTCCAGTAAAATCGTTTATATAATGACAAATATCCTTGCAGCAAATTGAGCCGCAAATAGCCAAAATGCGCCTTAAGTTCTGGCACGACTCCATAGACAAGTGCTTTGAGCCGGATTCCCAAAGATCGTACGTGGAGGACCAGCCTGTCCTGCGCGAACTGAAGCACACGGTGGGCAGTCGCAAGCTAAATAAGGTATATTTGCGCCGTCTGGTCACAGCACGGGAACGTCCGCCCACGCATGCATTTGAGTCGATACGCGAGCTGGAGGAGTACACGGAACAGACCTTCTCTTCGCTATTGCTCCTGCTGTTGGAGGTGGGCGGAGTGCGTGACCTAAATGCTGATCATGCCGCCTCCCACTTGGGCAAGGCCCAAGGCATCGCCACCCTGCTGCGATCGATACCGCTGGCAGGACGTCAGCAGGCGCCCTGCATTCCGCTCGAGGTGCTGGTGCTGCATGGCGTCAGCCAGGAGCGCATCATTCGCTCTAAGAGCGACGACAAGGGTGTCGAGGACTGTATATTCGATGTGGCCAGTGCCGCCAATACGCACCTAAAGCTCGCCAGGCAGCTGCACGATAAGGTGCCGCCGCAGGTGCGCAAGATCTTCCTCTCCGCCGTGGCCACGGATGCATATTTGGAGCGCCTCCGCCGTGCCAACTTCCTGTGAGTTCCTTTGTTTTATATTGCTTTGTTTTATATTACGACAAACACAGGAGAGAACCAGCTTCTTTTTGTAGTTAAGATGTTATTTTTATCCAGTTATAAGTACGATTTGCCTTTATTGAGACTTCTTTATTTCAAAACCTAGCTATAGTTTGTTGGTTGTTCAGTATTCATGGAGCGGACCCTTCTTT


Search Again