CR00429

CRIMIC CR00429

Gene N

CG3936

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78910

Images

Construct Sequences

sgRNA sequence
TGAGTGCATGATAAGAGGGGGGG

Amplicon 5' Amplicon 3'
TAAGGCCATTTGCTAGGGCGCCAGAAGAACCGGCGTTCCTTCGTTGACAAATTAGCAGAGGTGGAAAGTAAATATGAATTGAAGACTCTGGCCTTTTTTTTTTCTTTCTTTCATCCATTTCAGTTTTGTCGTTTTCGGAACTTTAACTAAACATTCACACGCTGCTTTGTTGTCTGCCGGAAGTGTTAAATGCTTCAGTTTATTTAAAGTACATATAGACAAGAGGAGTAAAAGAGAGAGAGGAGACTCCATACAATATCACTCATATGCCATTATTTTTATGGATTTCCGAGCAACAACCCTTTTTGTTTGTGCGCCTGCGCGGCCTTTTTTCAGTTTGGCGCGCATTTCCTTCAGCCTCGACCTCTTGAACTCCAGCTCTTGCTCTCTCACTCTCTCCCTCTTCTCTTCTCTCTGCTCTCTCCCTCTCTGCACGCATTTTATATGTTTTTGCCCCGGCGAGGGCGGATTTTGTCAAAGTGTCGCATATGTTTTCAAGTGCACTTCAATTACCAAAAATACAAGAAAAAAAAAACCATATACTTATGTACATGCATATAGATTACTTACAACTGCAGCTGTGTGTCCTTCCTTTCCGGAGGGCTGTTTATCACTCATCCTCCCTGCCAA ACATCGTCGGGTAGGTCAATTATTCCCATAATATTATCTTTCATTTGGCTAAGCATTATGCTAATCATCCGAGCTTCTCGTGTGGGAAAATAAAGTGCGAGTCGTCGTGGAAAACCGGCGGGGGAAAACGGAGTGATGATCATCAAGTGGAAACAGCGCTCAACTGTGAAAAGTTTTGCGTCTTGTAAATGGGTTTTTTTTCTACTTACCACACTTAGTTTCATTATCAAAGACAATTTCAATGTTAACAATGAAGTTCATAATATATTCTATTAGGTTATATTATAAACAATCCTGCTAAACAATCCGTTTGAATTGAACAGCTAGCGCTGTAATAAGTTTCCTGTTTCTTTCTATTAACAAATTATATATTATAATATTTACAAGTGAAGACATCAATCAGGGTGCCCATAAACCACATTCACAGGCACTTCCCCTTCGGTTATTCGCCCCTTTTTCAACGATCGTCTAATCCGAAATCTAATTCCAACATATGTTGCAATAGCAATATCGTAGACCGCAAAAACCACATACTTCCTCCCCCA


Search Again