CR00428

CRIMIC CR00428

Gene CG1544

CG1544

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78909

Images

Construct Sequences

sgRNA sequence
TAATTAGTGCACTGCACGGGGGG

Amplicon 5' Amplicon 3'
CCGTCGAGATAACCATCGCATCGATAAGAGTCTTTCGGGATCAAACATTCATATGAATGGGCAGTGGAAATCTACCCAAGCAAAAAGAAAAACCGACGAAGTGACATTGTGTGCGTGTGTGTGCGTTCGTGTCGGATTTTCCAGCCGGCTATTTATCAGCGGAATTCAAGCAGCTGACCCACAACAATCCCCGCAGAAACTGCAATAAAACAACAGCCTGAACAAGAGATCAAGTGCAAATTGCTGTGGGTGAATTCGAAAACCAGTTTAAAGAAGATATATCATTTGTATACCCTGTAATCGGAGGGTATATACGGGAATACGTATGGATACCTAGGATTATTTTCACTAACTTCAGGTTTAACTTAATTTCGCAAAATATTTTTTAAATTGAAGTTCATTGTTTATGCCTCTCATACTATCGAGAAAGAACAGCTCCTGTTGACTGGTGGAATATTTTTTATGGTTTTAATGTTACCGTCTTTCCTGTTACCTACCCAAGCTAATCTCCACGTTCTCAGCTTATCACATGTTTTCACTCTGAAATCTGATAAACCCGAAATATATGGCGCTACACCCAGTACCCCGAATTTATAATTAGAATGAGGAGATTGTGGCAGACCCC GTGAAGAGAGGCGGATGTCCAGTGCAGAGATACTATATCTTTTCCCAAAACGCACGGCAGGGAGTCCAAAAAGGACCCGGCTAAATATCAAAGCCCGGCAAACAAAGGACCCCAAAACGGGAGCTTCTTTGTGCTTGTCCTGCATCCGTTGCGTACACAATTGGGGCTTATCGACACCATGGCCAACAGACACCAGTCACCAGTTGGTAGTTGGTAGTTGGATAGTCTGCCAGGAGCCTTTGACTGGGCACCAGAGGAAAGCCTTCAACGCTTGACCATGTGACATCAGGCGCCTAGGATGATGCACATAGAGAAAATCAAGTCTAGGATTTACTCAGGCTTTGGAAAAGTATGTTAGATATTCTAAAGCAAACCCAATTGACCAGTATTTTGAATTATGGTAAAGCGTACTAAAACTGACTTTAAGCGTTAGTTTTGCCTCAGTGTAGTATCGGTATAATTCGCCTTGTTTGCCGTTCGTCCTTTGGCTGCATTTCTGTCAGGGCAATCATTATCCTTGGCAAAGGACGCGCCGCTGTGCTCCAATAATATTTACACGCTCAAGCTGAAATGTTGTCACCGCAAATACAATTCATCATACACCCTGTGCTCCTGTCCAAGCGACCTACTCTTTAACATTAAATTGATTTATGGCCGAAATGCCGTCGAGAAATTGCATAAATTTCTGAGGACGACTTGGGGTCGGTCTAACTGGCAAA


Search Again