CR00424

CRIMIC CR00424

Gene kraken

CG3943

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78908

Images

Construct Sequences

sgRNA sequence
GGTGAAATCGCCCGCGGGCCAGG

Amplicon 5' Amplicon 3'
CTGCGTCGCTTGTTACCTTGCCGGGAGCCACCCGCCTCTGGTCTTCTTCTTCGTCGGACAATCCTTCCAGGCGCATGGGGTCCACTTGGCGTGATCTTCCGGCGAAGGAGTGAGCTCCGCCTGAGGCGGCAGCAGTGGCGGTGGCCCTCATTACCGTGTTAATGGACCTGGCGGTCATGTCACCGCGCGAATGGACATCCTGTGCGTACGACTTCATGGCCGCCTCCTCCATCTTGCGGATCTCCGCGTCCATTTTCTGGCGCTCCCGCTCCGATTTCTCGCTGTTGCGACTGATGTCCGTGATCCGCTTGGCCACATTCATCTTGTGCCGCTTGCCACTCTCGTGGAAGGCGACGCTCTGCGGGATTAGGGGTCATTAGAGTGCCGAAAAGCGAGTTTATTCTATGGACTCACCGCCTTGTTGTCGCTCAGCCAGCATTTGCAGAAGTCGCAGAACTTGCGCTCGTTTGATTTCCAGTACTCCGTCCTGTTGGAATCGAGAGTTAGCTATGGCAAAGCCGGAGGATAATAACGCAGACTTACATGATGATTTCTCAGCTTAATTGTTTCGAATACAAGTAATATTAAATTTTGTTTGCAATCGCAAATGAAAACAATGTGCGGGAGTTGCCACCCAGTCGCGAATGGAGCTGCACAATAGCTCCGTATCTGACTTTCTAGCCATTCCACCGCCAAACCGACATATCTGTCAATAGCTATTGACAATCGAATTCCGTTGATCGGCAAAACTTTGCGACTTTAGTTAGTCGCTTTTTGAGATTCCCCGAGGCAGGAGCTCGCCCGATCCGCGTCCAGCATTACGGAGCACCATTTGCGAGCAGCAATTAGCCATGGGCCAGACACGCGTGGCAGCAACAACAGCGGCGCAATCTCCCGCGGCGGAACTTTCGCCAGAGACAAGTGAGTAAACCGGAGGAGGAGGTCGTGGTCAGGTCACCGACTCGCACGCTCTGCGCACCTGAGTCCGAAGTTTCCGCTGGTTG ACGCAGACCATTTCGTCACAGCTTGCTTTGGTTTTAGTTGAATTACTTATGTGGATTCCCCCTGCTTTCAGATGGCCAGACGGAGGAGCCCCTGCAGCTGCTGGGCGAGGACAGCTGGGAGGAGTTCTCTATCGCGGTGCCCTGGGGAACCGTTGAGGGTGAGTCACCTGCCAGCCGTTTCCTAATCAACAGCATCGACCATTCATGGCAATCCGACGTGATTTTCGATGTGACGCGGCTAAAATATTTTGTTAGTTTCGACGCACTACAAGTGTTCTACTAACTGAGCCCAATAACGCTATCTCTTTGCTTGTTTTTTGAGTAATATTTTTTGGAAACATCACGCGATTCCCCTGAACGATTAACATACACGTGCTGAAACCAAGTTACATACATATGTACTAATCGATTTTCCCGCTTGCAGCCAAGTGGTGGGGCTCGAAGGAGAGGCAGCCCATCATCGCCCTGCACGGCTGGCAGGACAACTGCGGCAGCTTCGACAGGCTGTGCCCCCTGCTACCGGCGGACACCTCCATCCTGGCCATCGATCTGCCCGGGCACGGCAAGTCGTCGCACTATCCGATGGGCATGCAGTACTTCATCTTCTGGGACGGCATATGC


Search Again